TABLE 1.

Bacterial strains, plasmids, and primers used in this study

Strain, plasmid, or primerDescriptionReference or source
K. pneumoniae
    43816Serotype O1:K2ATCC
    43816-0143816 with a plasmid cointegrate in wbbOThis study
    CWK2An O1:K strain used as a positive control for LPS electrophoresis analysis 24
E. coli
    BW20677 E. coli for conjugation of suicide plasmid pLD55, pir+ 14
    DH5αFφ80lacZΔM15 Δ(lacZYA-argF)U169 deoR recA1 endA1 hsdR17(rK,mK+) phoA supE44 thi-1 gyrA96 relA1 λInvitrogen
Plasmids
    pWW84pUC containing kanamycin resistance cartridge 16
    pBC KS+pBluescript with chloramphenicol resistance cassetteStratagene
    pLD55pBluescript II (SK+) F1(+)ori lacZαTetsoriRR6Kλ 14
Primers
    5′ wbbO (internal fragment)CGGGATCCGGTGCAGGCATTAATCCAGAGA (BamH1 site underlined)This study
    3′ wbbO (internal fragment)ACGCGTCGACACCCATTTCAACACGTGCTTTAGG (Sal1 site underlined)This study