TABLE 1.

qPCR primers

GeneForward primer sequence (5′ - 3′)Reverse primer sequence (5′ - 3′)
ureA (HP0073)aAACCGGATGATGTGATGGATGGTCTGTCGCCAACATTTTT
cag3 (HP0522)TTTGGGGATTGGTTTGGTAATTAGCGTTGCGTTTGTTGAG
flgB (HP1559)GGCCAAAGGATTTGGATTTTCTTGCCCATTTCACTCGTTT
tonB (HP1341)TAAAATGGCGCAGATTAGGGGATGCACGGTTTCTTCTGGT
rho (HP0550)GTTACGCAAGGCGGATACATCGCCATTCCTTAAAGCAAAA
deaD (HP0247)CTACACCAGGAAGGCTGCTCTTTTAATCGGCTCTGGCATC
flaA (HP0601)GAACTCTAACCGAACAGGCGTTACCCAAATGAATCCCATTTAAGGT
sodB (HP0389)GGATTGCCTAAGCCCCAAAGCCAATTCCAACCAGAGCCAA
HP0874AGAGTTTGCCCTGGTTTGCACTAGGAGCGTTTTTCACCACG
  • a The designations in parentheses are the locus names in H. pylori strain 26695.