TABLE 3.

Genetic basis of P. mirabilis transposon mutants

Group, transposon mutantP. mirabilis DNA sequence at transposon junction (5′ to 3′)aPutative identity of disrupted genetic locus
1, Control mutant BVJ14CTTTAGTGGTTGCAAACTCA cirA-like CDS for an outer membrane receptor for colicin uptake (COG1629)
2, Poor-swarming mutant G77CTAATGTCCACAGTATTAAGIntergenic mutation between acrR-like transcriptional regulator CDS (COG1309) and methyl-accepting chemotaxis protein CDS (pfam00015)
3, Nonswarming mutant G93GTGTAGACCAACACCTGATT surA-like CDS for a parvulin-like peptidyl-prolyl isomerase (COG0760)
4, Nonswimming, nonswarming mutant NS63GTGTTACATAAAGTATTGCA flhA homologue part of flagellar biosynthesis pathway (COG1298)
  • a The disrupted locus for each mutant may be obtained by matching each sequence to the P. mirabilis genome project as described in Materials and Methods.