TABLE 1.

Primers used for RT-PCR

ChemokineSense primerAntisense primerPCR product size (bp)
I-Ab alpha chain5′ATGCTCAGCCTCTGTGGAGGTG3′5′CGTCTGCGACTGACTTGCTATT3′424
Mig (CXCL9)5′TGCCATGAAGTCCGCTGTTC3′5′GGGGTGTTTTGGGTTTTCTG3′353
CX3CL15′TCACCAGGCTGCTGCCCTCACTAA3′5′TGGCCTTCGGACCCAACATT3′465
ABCD-1 (CCL22)5′ACTCCTGGTGGCTCTCGTCCTT3′5′CCTGGGATCGGCACAGATAT3′220
TARC (CCL17)5′ATGAGGTCACTTCAGATGCT3′5′ATGTTTGTCTTTGGGGTCTG3′240
MCP-5 (CCL12)5′ATGAAGATTTCCACACTTCT3′5′CTTATCCAGTATGGTCCTGA3′213
CXCL165′TTGTTCTTGTGATCGTACCA3′5′TGAAGGGAGAGTGGTCATCT3′400
MARC (CCL7)5′ATGAGGATCTCTGCCACGCT3′5′GGAGTTGGGGTTTTCATGTC3′284