TABLE 2.

P. aeruginosa AlgU (σE) promoter consensus sequence in front of the lpt genes

Gene category and no.Gene nameAlgU consensusaDistance (bp) from initiation codon
Lpt-encoding genes with AlgU promoter consensus sequence
PA0737lptDTCGAACTGGATCCGTTCGACGATGGCTACTACGGCT155
PA1323UnknownCTGAACTTTTTCACTGCGGCGCCTATCAACTCCTTT30
PA5526lptGAAGAATTTCCCTCGATTGCGACGGTCACAAGGGCAA55
PA1592lptATGGAACTTCACGCCAGCGCAAATGTTCAAAGGGCTA35
PA3262lptBTTGAACTTATCCGCGCGCACCTGTTCCTATTGCCCA82
PA3819slyBTGGAACTTGGTGGTTTTTGCCCAGTCCTAGGCAAGG60
PA4876osmEGCGAACTCTGCGCGAGGGCCTGCGTTCCAATGTTCG37
Lpt-encoding genes with no discernible AlgU promoter consensus sequence
PA0062lptC
PA3691lptE
  • a The AlgU consensus sequence was GAACTT-(16 or 17 bp)-TCCAA-(5 or 6 bp). The consensus matches are shown in bold; underscored residues map mRNA 5′ ends.