TABLE 1.

Nucleotide sequences of oligonucleotide primers used for PCR-based cloning procedures and RT-PCR analyses

PrimerSequence (5′-3′)
413 CTGTGATGTGTGCGGTAAG
414 CAACCAAGCGATTATCCC
417 AGATCTGGGTGACTAACTAGGAGGAATAAATGGCTAa
424 CGCTTCAGATTTACATTTATCCGC
425 ATTTGTTCGTTGGCAGTGG
428 TTCTGCCATTTGCCCAACCC
429 AACAAGCGTTACTTCTCCACTG
430 CGGTGTTTTGGCGATGTTTG
431 TTTTGGAGTTGCTTGGGATGTC
454 CATCTGATTGAAGCGGTC
455 AAATGTTTGGCAAGCAGC
491 CTCGAGGTCGACTCTAGAGGATCCCCGGGTCATTAb
597 GTTACCCAAACAGCAGAG
598 ATACCACCAAGAACGACG
631 CTCGAGGCTGTTTTTAGTGGCAATGb
632 AGATCTCCTTGTTGTGCTTTCATACGa
633 CATATGCCTCAATACCAAAAACGCc
634 GGATCCTAGTTAAGTTTTTGGAGTTGCd
655 CTCGAGGAGGTTATCTCAACACCAAAAGTCb
656 AGATCTGGTCATACTGCCTGTCACACTATCa
657 CTCGAGTGCCCCCAAAGAGCATTGACCb
658 AGATCTTACATTCACCCGAAAGCGAGCGa
709 ATGGCTGTCTCATCGCATC
710 ACTCCTCTGGTGTTGGTTCAC
780 GAAAGCACAACAAGGATTTACCTCTC
781 AAGCACATCTCAACAGCCCG
782 CCGATGATAGTGTGACAGGC
783 CCGTGATAATGGTGCTTCAG
  • a Engineered BglII site is underlined.

  • b Engineered XhoI site is underlined.

  • c Engineered NdeI site is underlined.

  • d Engineered BamHI site is underlined.