TABLE 2.

Primers used for PCR amplification

PrimerPurposePrimer sequence (5′→3′)a
exoT5Amplification of exoTATATCCCATCGGGTTCTCCGCCCCGG
exoT-CM-2Amplification of exoTCGTTTCGTTATGCAGGAAGC
exoSl-FAmplification of exoSTCTGAATTCTTCCAGGCGGGTGAACATCA
exoSl-RAmplification of exoSTTTAGATCTCACCCTGGTATCCAAGGCGA
70.6Amplification of exoUGCAGCCTATCGTGCAAG
70.9Amplification of exoUAGCGTTAGTGACGTGCG
pscJ-5′Amplification of pscJCAGTCTCGAAGAACTCTCCG
pscJ-3′Amplification of pscJTGCGCCGTACCCGCGCACCG
R146A-forwardMutagenesis of exoSCGGAGATGGGGCGCTGGCTTCGCTGAGCACCGC
R146A-reverseMutagenesis of exoSGCGGTGCTCAGCGAAGCCAGCGCCCCATCTCCG
E379A/E381A-forwardMutagenesis of exoSCGAACTACAAGAATGCAAAAGCGATTCTCTATAACAAAG
E379A/E381A-reverseMutagenesis of exoSTTGTTATAGAGAATCGCTTTTGCATTCTTGTAGTTCGAT
  • a Nucleotides altered for insertion of point mutations are in bold and underlined.