TABLE 1.

Characteristics of bacterial strains and primers used in this study

Strain, plasmid or primerCharacteristics and/or sequencesSource and/or reference
Strains
    A. pleuropneumoniae C1569A. pleuropneumoniae serotype 9, clinical isolateDiagnostic unit of the Department of Infectious Diseases
    Escherichia coli TOP10 F′F mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 rec A1 deoR araD139 Δ(araleu)7697 galU galK rpsL (Strr) endA1 nupGTOPO TA Cloning (Invitrogen)
Plasmid
    pCR 2.1-TOPOTopoisomerase I enhanced E. coli cloning vectorTOPO TA Cloning (Invitrogen) (35)
Primers
    M13 forward5′ CAGGAAACAGCTATGAC 3′Amersham Biosciences
    M13 reverse5′ GTAAAACGACGGCCAG 3′Amersham Biosciences
    oSCOTS-N9-15′ GTGGTACCGCTCTCCGTCCGA-N9 3′8
    oSCOTS-N9-25′ CGGGATCCAGCTTCTGACGCA-N9 3′8
    oSCOTS15′ GTGGTACCGCTCTCCGTCCGA 3′8
    oSCOTS25′ CGGGATCCAGCTTCTGACGCA 3′8
    oRRN16-15′ TGGGTCGTAGGTTCAAATCC 3′This work
    oRRN16-25′ GCGTCAGTACATTCCCAAGG 3′; amplifies 5′ end of 16s rRNA sequence; product size, 990 bp
    oRRN16-35′ TGTAGCGGTGAAATGCGTAG 3′This work
    oRRN16-45′ ACTTGAACCACCGACCTCAC 3′; amplifies 3′ end of 16s rRNA sequence; product size, 1,000 bp
    oRRN23-15′ TTGGAAACAAGCTGAAAACTGA 3′This work
    oRRN23-25′ GGACAGGAACCCTTGGTCTT 3′; amplifies 5′ end of 23s rRNA sequence; product size, 1,480 bp
    oRRN23-35′ TCAGAAGTGCGAATGCTGAC 3′This work
    oRRN23-45′ CTGGCGAGACAACTGGTACA 3′; amplifies 3′ end of 23S rRNA sequence; product size, 1,466 bp
    oADH75′ ACACGTAATGACGGCGGTA 3′This work
    oADH85′ CGAGTGGATTCACCCAATTT 3′; amplifies a 158-bp product from an A. pleuropneumoniae autotransporter adhesin; acc. no. ZP 00204542
    oFLPD15′ TTTCTCTGTAGAGATGGTTTGTGC 3′This work
    oFLPD25′ AACCCAATTAACCCAAATGGT 3′; amplifies a 154-bp product from an A. pleuropneumoniae fimbria-like protein; acc. no. NP 873737