TABLE 2.

Constructs and primers used for making C-terminal fusions with MalE in pMAL-p2

PlasmidFusion proteinaPCR primer (sequence [5′-3′])bPCR product size (bp)
pAB206MBP-CfaB24-170CfaBXbaF (GCTCTAGAGTAGAGAAAAATATTACTGTAACAGG)467
CfaBHindR (CGCCCCAAGCTTTCATCAGGATCCCAAAGTCATTACAAG)
pAB202MBP-CfaE23-211CfaEnEcoF (GGAATTCGCAGATAAAAATCCCGGAAGTGAA)585
CfaEnXbaR (GCTCTAGATCAGAACTGTGGTAACCATATCTGAAT)
pAB201MBP-CfaE212-360CfaEcEcoF (GGAATTCAAAAGTAACGCTCGTGTCGATCTT)468
CfaEcXbaR (GCTCTAGATCACTAGAGTGTTTGACTACTTGGTGT)
pRA1MBP-CsbD19-214DMalBamF (GTACTGGATCCGGGCGATACCCGGAAACTACA)614
DMalHindR (GTACATAAGCTTCTAAAACCCTGGAAGCCATACCTG)
  • a The subscript amino acid residue span of the corresponding protein is numbered with respect to the full-length protein.

  • b Primers were used for the generation of pMAL-p2 insertion fragments. Flanking restriction enzyme sites introduced for cloning are underlined.