TABLE 2.

PCR primers used to construct STa recombinant, STa mutant, and pLT192:pSTa12 and pLT192:pSTa12 chimeric strainsa

PrimerSequence (5′ to 3′)Description
184EcoRV-FGTCAGGCACCGTGTATGAAATPlasmid pACYC184 sequence at the EcoRV site
pBREagI-RGTCCCTGATGGTCGTCATCTPlasmid pACYC 184 sequence downstream at EagI site
STaSfcI-FGTGAAACAACCTGTAGGGATo amplify native estA gene, cloned into pACYC184
STaEagI-RGTGGAGCCGGCCGAAACATo amplify native estA gene, cloned into pACYC184
STaHindIII-FTGCAAAATAAGCTTAACTAATCTCTo amplify native estA gene, cloned into pUC19
STaBamH1-RGTGGAGCCGGATCCAACAGTo amplify native estA gene, cloned into pUC19
pSTa11K-FGAACTTTGTTGTAAACCTGCCTGTPairs with pBREagI-R to mutate the 11th amino acid
pSTa11K-RACAGGCAGGTTTACAACAAAGTTCPairs with 184EcoRV-F to mutate the 11th amino acid
pSTa12F-FCTTTGTTGTAATTTTGCCTGTGCCPairs with pBREagI-R to mutate the 12th amino acid
pSTa12F-RGGCACAGGCAAAATTACAACAAAGPairs with 184EcoRV-F to mutate the 12th amino acid
pSTa13Q-FTGTTGTAATCCTCAGTGTGCTGGAPairs with pBREagI-R to mutate the 13th amino acid
pSTa13Q-RTCCAGCACACTGAGGATTACAACAPairs with 184EcoRV-F to mutate the 13th amino acid
pLT:STa-FGCAATCAGTGGGCCGGGGCCCATGAACAACTTTTACTGCTG3′ end of LT + linker + 5′ end of STa
pLT:STa-RGTTGTTCATGGGCCCCGGCCCACTGATTGCCGCAATTGAATTGG5′ end of STa + linker + 3′ end of LT
STa12NS-RATAACATCCAGCACAGGCAAAATTSTa12 mutant without stop codon, for TA cloning
ST13NS-RATAACATCCAGCACACTGAGGSTa13 mutant without stop codon, for TA cloning
LT-RGTTTTTCATACTGATTGCCCCAATTGTo amplify LTAB genes without stop codon
STa-FAACAACACATTTTACTGCTGTGTo amplify the STa gene without signal peptide
hLT-FATGATTGACATCATGTTGCATATAGGTo amplify LT192:mSTa fusion genes, for TA cloning
  • a Bold indicates the target amino acid to be mutated for STa toxoids, underlining indicates the enzyme restriction site, and italic indicates the Gly-Pro-Gly-Pro linker. Primers pLT:STa-F and pLT:STa-R were used to fuse the mutated porcine eltAB (encoding pLT192 protein) with the mutated porcine estA (encoding STa12 or STa13 protein) genes.