TABLE 2.

Primers used in this study

PrimerConstruct or use(s)Sequencea
5′SapA ForwardpMEB078CATATCtctagaGCGGATAGCTTAATTTATTGCACCAG
5′SapA ReversepMEB078CATATCggtaccCATATCctcgagGAATCTTTACTGTATATTCATTCGGTGCTG
3′SapA ForwardpMEB080CATATCtctagaGCGGATAGCTTAATTTATTGCACCAG
3′SapA ReversepMEB080TAAACGAACTTGCCCGAATGGCTC
SapAcompFor1pMEB108GATGTATCATTACTCACTAATATCCCTGCT
SapAcompRev1pMEB108CGGTCGAAATCCAACAGAACACAG
SapPromoterFor1pMEB114CCTTTAATTTGTTCTAAATACATAATGATCC
SapPromoterRev1pMEB114CATATCcatatgTCTTTTCGCCTTAATTTAAGC
Sap Forward 2Nested RT-PCRCGGATAATTCGGTGTTGGCGCATT
Sap Reverse 3Nested RT-PCRTGTGCACTCGACCTGTATGCGGAT
Sap Forward 5PCR of clinical isolatesGCATTTCTCATACTGCGGTGGCAA
Sap Forward 6Nested RT-PCRAATGCGCATATTGAGCCATTCGGG
Sap Reverse 6Nested RT-PCR; PCR of clinical isolatesATCCGAGCGGAATCCCGATAATCA
  • a Restriction enzyme sites are shown in lowercase type and underlined.