TABLE 2.

Primers used in this study

Primer functionRelevant gene or gene productPrimer nameSequence
Gene deletionFPrLH55TGCTCCACCACAGCCATCACT
LH56TAACGAGCGGCCGCACATTCTTAACTCCTGTCTGCC
LH57TGCGGCCGCTCGTTAGGCTTAGGCGAAGGTTAAGG
LH58TCATGCTGCGCAGTTGGGCA
NPrLH43CTGCTTGGCCCACTCAAAG
LH44TAACGAGCGGCCGCACATAGGGGCTCCTAGGATTG
LH45TGCGGCCGCTCGTTAGAGTAAAGCTCCTCACTAGC
LH46GTGACACATCATCCGGCAAG
EIIANtr1LH121CTCAGTGACAGCAAGATCGCA
LH122TAACGAGCGGCCGCAGGTGCAGTCCAATGAAAGTAC
LH123TGCGGCCGCTCGTTAAGCGATCAAGAGCTGTACAACATC
LH124GACTGAAACACCATCACAAGGTC
EIIANtr2LH49TCGCTAGAGTAACGAGCGAT
LH50TAACGAGCGGCCGCACATCATGCCAAGGATCAGCG
LH51TGCGGCCGCTCGTTACTGATGTACGCGATGTCACGC
LH52TGTTGCTGCAAGCTCTCCTTCA
Gene insertionVC1820LH87ATATGAATTCCTCATCAGTTAAATACTTTATGAGCC
LH88TATAGAATTCTTACATAAATATGGTGGTCTGCGCC
VC1822LH89ATATGAATTCCCCATCTGATCGAACCTGAAATC
LH90TATAGAATTCTTACGGCTGGTAATCGGCATAATCCAT
VC1826LH91ATATGAATTCGCAAGCGAATTCCAAACAAGCCGT
LH92TATAGAATTCTTAATCAGCCCTTTGCTTTCTGCTTGG
EINtrLH71ATATGAATTCTTGCGCGCATGTCGGATGTTTATC
LH72TATAGAATTCTTATCGATTCGTGCGCCATCAAGAGTA
VC1283LH192ATATGAATTCGATTCAGTTGGGCTTTGTCGGTA
LH193TATAGAATTCTTACCTGTGCCAGAATTGTCGTCA
VCA0245LH151ATATGAATTCCAACTCAATCCAACTGCAAGCCAAAGCC
LH152TATAGAATTCTTACTACGCGATGTGCGCTAATTCTTGTTGG
VCA1045LH105ATATGAATTCGGAGAACATTCACCTTGGCCTGAA
Mutant rescueFPrLH61TTAGAACTCACTACACAAGATATTC
LH62ACCTTCGCCTAAGCCAGCATTGATC
FPr(309-401)aLH195CGCGCTCATACGGCGACTTT
HPr(H15A)LH17AAAACGGCCTTGCCACTCGT
LH18ACGAGTGGCAAGGCCGTTTT
FPr(H324A)LH59AAATAGCCATGGTCTGGCCGCTCGTC
LH60GACGAGCGGCCAGACCATGGCTATTT
Use in quantitative RT-PCREIACCGTTATCGAAGAGCAAGCCACT
TCTGCGCAGTTTCAGAAGGCGTTA
EIIAGlcGCGATCAAGCCTGCTGGTAACAAA
AAGCCTTCACCTTTCAGCTCAACC
HPrTGTTCAAGCTGCAAACGCTAGGTC
GCAACTAGGTGCTCAACAGCTTCT
FPrATCACTGAGGAAACGATAGCCGCA
ACTTGACCATCGCCATCCAGGTTA
ClpXAGAGTTCATTGGTCGTCTGCCTGT
AACAACGCCGCATACTGTTTGGTC
  • a FPr(309-401), fragment of FPr comprising positions 309 to 401.