TABLE 2.

Primers used in this study

PrimerSequenceNote
P15′-CATGGATCGTACTAAACTGGTACTGGGCGCGGTAATCCTGGGTTCTACTCTGCTGGCTGGTTGCTCCAGCAACG-3′Amplify the lpp gene signal peptide from Salmonella serovar Typhimurium LT2 with P2
P25′-TCGACGTTGCTGGAGCAACCAGCCAGCAGAGTAGAACCCAGGATTACCGCGCCCAGTACCAGTTTAGTACGATC-3′
P35′-CATGGAGACTGTTCTCATGAAAATGAAATGTTTTGCGAAAAATGCGCTGGCGGTTACCACACTAATGATCGCTGCTTGTGGTATGGCAAACGCTTCTG-3′Amplify the signal peptide of the psaA from Yersinia pestis KIM6+ with P4
P45′-TCGACAGAAGCGTTTGCCATACCACAAGCAGCGATCATTAGTGTGGTAACCGCCAGCGCATTTTTCGCAAAACATTTCATTTTCATGAGAACAGTCTC-3′
P55′-CCGGGATCCTGCTAGCGGTAAAAAAGATACAACTTCTGGTCAAAAACTGAAAGTTGTTGCTACAAAC-3′Amplify psaA fragment without Cys (aa 21 to 210)
P65′-CCGGGATCCTTGTGCTAGCGGTAAAAAAGATACAACTTCTGGTCAAAAACTGAAAGTTGTTGCTACAAAC-3′Amplify psaA fragment with Cys (aa 20 to 210) with P9
P75′-CCGGGATCCTCTTGTAGCAGCTAGCGGTAAAAAAGATACAAC-3′Amplify psaA fragment with LXX (aa 17 to 19 and 21 to 210) with P9
P85′-CCGGGATCCTCTTGTAGCATGTGCTAGCGGTAAAAAAGATACAAC-3′Amplify psaA fragment with LXXC (aa 17 to 210)
P95′-GCCGAAGCTTTAGTCGACGTATTTGAATGCACCTTCGCTGGTTACAATGAG-3′
P105′-GCGCAGTCGACGCTAGCGGTAAAAAAGATAC-3′Amplify psaA fragment (aa 17 to 210) with P11
P115′-CGGTGCAAGCTTATTAGTATTTGAATGCACCTTCG-3′
P125′-AAAAAATTAGGTACATTACTCGTTCTCTTTCTTTCTGCAATCATTCTTGTAGCATGTGCTAGCGGTAAAAAAGATACAACTTCTGGTC-3′Amplify psaA fragment (aa 1 to 210) with P11
P135′-GAGAAGTATTTGAATGCACCTTCGCTGG-3′Amplify psaA fragment (aa 1 to 211) with P12
P145′-CCAGCGAAGGTGCATTCAAATACTTCTCTAAAG-3′Amplify psaA fragment (aa 204 to 309) with P15
P155′-TATAAAGCTTATTATTTTGCCAAACCTTCAGCAATCTTGTC-3′Amplify psaA fragment (aa 1 to 309) with P11
P165′-TCTGCATATGAAAAAATTAGGTACATTACTCGTTCTC-3′Amplify psaA fragment (aa 1 to 309) with P17
P175′-TATACTCGAGTTTTGCCAAACCTTCAGCA-3′
P185′-CCTGGTACCTAGGCCTCTAGATAAATAAAAGCAGTTTACAACTCCTAGAATTGTGAATATATTATCACAATTCTAGGATAGAATAATAAAAGATCTCTGCAGGGC-3′Amplify T4 ipIII terminator with P19
P195′-GCCCTGCAGAGATCTTTTATTATTCTATCCTAGAATTGTGATAATATATTCACAATTCTAGGAGTTGTAAACTGCTTTTATTTATCTAGAGGCCTAGGTACCAGG-3′
P205′-AGAGGTACCCTCGAGGCTAGCCCAAAAAAACGGG-3′Amplify PBAD araC terminator with P21
P215′-TGGTCTAGAGTCAAGCCGTCAATTGTCTGATTCG-3′
P225′-GGAATTCTCACTGCCCGCTTTCCAGTCGGG-3′Amplify lacI with P23
P235′-CCGCTCGAGAGGGTGGTGAATGTGAAACCAGTAACGTT-3′SD sequence is underlined, and the GTG start codon of lacI is in boldface type
P245′-CCGCTCGAGAGGATGGTGAATATGAAACCAGTAACGTT-3′SD sequence is underlined, and the ATG start codon of lacI is in boldface type
P255′-CCCAAGCTTGAGCTCGAGGGCGTTCCGGCGCTGGTAGAA-3′Amplify relA upstream sequence with P26
P265′-GAAGATCTAAGGGACCAGGCCTACCGAAG-3′
P275′-CGGAATTCACCCCAGACAGTAATCATGTAGCGGCT-3′Amplify relA downstream sequence with P28
P285′-CGGGTACCCCAGATATTTTCCAGATCTTCAC-3′