TABLE 2.

Oligonucleotides used in this work

Primer or useSequence (5′-3′)Location or usea
Cloning of VirR boxes
    JRP4051ACCAGTTATGTATAAATTTTGACCAGTTTTACCAVirR boxes upstream of netB (+)
    JRP4052TGGTAAAACTGGTCAAAATTTATACATAACTGGTVirR boxes upstream of netB (−)
Gel mobility shift analysis
    JRP589GGAACTCATATTATAATTGGUpstream of pfoA VirR boxes (+)
    JRP618CTCTAATTTTTTCTTTTCCCDownstream of pfoA VirR boxes (+)
Construction of pJIR3566
    JRP2712ATGATCAAGCTTGCATGCAAAAAATAAACTGAGAAAATGATATACgdh promoter (+)
    JIR2713ATGATCAAGCTTCATACCTAATTTATCACATGCgdh promoter (−)
    JRP4613ACGCGTCGGAAACGTAAAAGAAGTTATGGAAATAAGConstruction of ermB-RAM cassette
    JRP4614GAACATAATGCTCATGTAATCACTCCTTCTTAATTACConstruction of ermB-RAM cassette
    JRP4615GAGTGATTACATGAGCATTATGTTCAGTAAGGTCGTTAATCConstruction of ermB-RAM cassette
    JRP4616CTTGGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACConstruction of ermB-RAM cassette
    JRP4617CTCAGGCCTCAATTAACCCAAGAACAAAAATATAAAATATTCTCConstruction of ermB-RAM cassette
    JRP4618ACGCGTGGGGAATTATTTCCTCCCGTTAAATAATAGConstruction of ermB-RAM cassette
    JRP4619GAGTATTTATGAAAAGCGGReplace native promoter of ermB-RAM with pasfdx promoter region
    JRP4620ATACAATAAGTTATGAGAAGGAGTGATTACATGAGCATTATGReplace native promoter of ermB-RAM with pasfdx promoter region
    JRP4621GTCGACACGCGTGAAGATTTAGGATTTACTGTAATReplace native promoter of ermB-RAM with pasfdx promoter region
    JRP4622GTAATCACTCCTTCTCATAACTTATTGTATCATGTTTTTAAACReplace native promoter of ermB-RAM with pasfdx promoter region
    JRP4042AAAAAAGCTTCAGGAAACAGCTATGACCATGATTACGCCTAGCTTCCATGCCTGCAmplification of lacZα (+)
    JRP4623AAAAAATGTACAGGTGTTGGCGGGTGTCGGGAmplification of lacZα (−)
Targetron
    JRP4106TGAACGCAAGTTTCTAATTTCGGTTTTAAGTCGATAGAGGAAAGTGTCTEBS2 primer to retarget intron to virR
    JRP4107AAAAAAGCTTATAATTATCCTTACTTAACAATAAGGTGCGCCCAGATAGGGTGIBS primer to retarget intron to virR
    JRP4108CAGATTGTACAAATGTGGTGATAACAGATAAGTCAATAAGGGTAACTTACCTTTCTTTGTEBS1 primer to retarget intron to virR
    JRP3867CGAAATTAGAAACTTGCGTTCAGTAAACTargetron universal primer
    JRP4240CGCGTCGGAAACGTAAAAGAAGTTATGGAAATAAGUpstream of ermB RAM (+)
    JRP4241CTATTATTTAACGGGAGGAAATAATTCCCCACGCGTDownstream of ermB RAM (−)
    JRP182GTTATGAAGTTCGTGCTTTTAGUpstream of targetron insertion within virR (+); also used to generate virR probe
    JRP2813ACGCGTTCATTAACATATTAAATCCCCDownstream of targetron insertion within virR (−)
    JRP111GTATTATTACCTTTCTCTCAvirR probe (−)
    JRP2633CCGGGATCCTTAGGGTAACAAAAAACACCcatP probe (−)
    JRP2142CTCAGTACTGAGAGGGAACTTAGATGGTATcatP probe (+)
    JRP3947GGGAACGAAACGAAAGCGTargetron probe (+)
    JRP3948CGTAATAAATATCTGGACTargetron probe (−)
    JRP2369AATAAGTAAACAGGTAACGTCTermB probe (+)
    JRP2370GCTCCTTGGAAGCTGTCAGTAGermB probe (−)
qRT-PCR
    JRP2479CCATCTGTTTTTATATCTGCTCCAGTAWithin rpoA (+)
    JRP2480GGAAGGTGAAGGACCAAAAACTATTWithin rpoA (−)
    JRP4707AAATATACTTCTAGTGATACCGCTTCACAWithin netB (+)
    JRP4708GAGGATCTTCAATAAATGTTCCACTTAAWithin netB (−)
  • a +, sense primer; −, antisense primer.