TABLE 1.

Primers used for quantitative RT-PCR determinations

Product of target genePrimer sequence
Forward (5′-3′)Reverse (5′-3′)
G3PDHCATTGTGGAAGGGCTCATGAGGAAGGCCATGCCAGTGAGC
TNF-αTGTGGCTTCGACCTCTACCTCGCCGAGAAAGGCTGCTTG
IFN-γGGTGACATGAAAATCCTGCAGCCTCAAACTTGGCAATACTCATGA
IL-4CGTCCTCACAGCAACGGAGAGCAGCTTATCGATGAATCCAGG
IL-10AAAGGCACTGCACGACATAGCTGCGGAGAACGTGGAAAAAC
βD3TCTGTTTGCATTTCTCCTGGTGTAAACTTCCAACAGCTGGAGTGG
βD4TCTGTTTGCATTTCTCCTGGTGTTTGCTAAAAGCTGCAGGTGG