TABLE 2.

Primers used for gene deletionsa

NameSequence (5′-3′)Restriction enzyme site(s)
pHFNotIAGCGCGGCCGCCGACTCCGTTGTTCCGTTGN
pHREcoIACTGAATTCCACCGTCGTCGTCAGCGE
pIE1H3FATAAGAATTCTACTAAGCTTATCGGCATCATCGGAACATTE, H
pIPstR2ATAACTGCAGTGCTCCAAGCCGACCTGTTP
aphA-3FGGATGTGCTGCAAGGCGATTAAGTT
aphA-3RCCGGCTCGTATGTTGTGTGGAATT
  • a Restriction enzyme sites are underlined. E, EcoRI; H, HindIII; N, NotI; P, PstI.