TABLE 1.

RT-PCR primers used in these studies

Gene assayedPrimer sequence (5′-3′)
ForwardReverse
MIP-2TCCATGAAAGCCATCCGACTGCATACATCCCACCCACACAGTGAAAGA
TNF-αACCACTCTCCCTTTGCAGAACTCATCTCATGCACCACCATCAAGGACT
IL-1βTGCTTGTGAGGTGCTGATGTACCATGGAGAGTGTGGATCCCAAGCAAT
IL-6AACGCACTAGGTTTGCCGAGTAGATGGCTAAGGACCAAGACCATCCAA
KCAGTGTTGTCAGAAGCCAGCGTTCAACCCAAACCGAAGTCATAGCCACA
iNOSATGTCATGAGCAAAGGCGCAGAACCTGCTGGTGGTGACAAGCACATTT
ActinAGAGGGAAATCGTGCGTGACCAATAGTGATGACCTGGCCGT