TABLE 1.

Oligonucleotides used in this study

FunctionPrimerSequence (5′ to 3′)
Creation of knockout genomic DNA for biolistics1A10.F1AAGGCGAAGAGGGAAAGAAG
    transformation (flanking the gene of interest)1A10.R1GCAGTGTTGTCCACCAGAGA
14A4.F1CTGTGAGCTATGAGTTTGACC
14A4.R1CAGTTGGGACAGTTTATTGC
7F4.F1GCAGATGATCGGGTGACTTT
7F4.R1ACACCTTTTTGTGCCTCGTC
Analysis of proper homologous recombination ofNAT.F1ACCTCTGGCTGGAGGTCAC
    gene constructNAT.R1GTGACCTCCAGCCAGAGGT
1A10.F2TGGGGATGACTCACATTATGG
7F4.F3CGTGCTAGGCTTCCTGATGT
14A4.R2GCTTGGGTTGTATGGATGGT
Creation of gene probe for Southern analysisNAT.probeFACTGGATGGGTCCTTCAC
NAT.probeRGGGCATGCTCATGTAGAGC
1A10.probeFGAAGTCGCTTTCCACAAAGA
1A10.probeRGACATGGAAAACAACCTTCG
7F4.probeFAGAACGGGTTGAAGAGAAGG
7F4.probeRAGCAAGGACTAGATGGATGG
14A4.probeFACTCTTCCAAACCACCTTCC
14A4.probeRTTTGACCTTGAGCTTGAACC