TABLE 1.

Bacterial strains, cell lines, plasmids, and primers used in this study

Strain, cell line, plasmid, or primerDescription or sequence (5′-3′)aSource or reference
L. monocytogenes strains
    F4244Wild type (serovar 4b); Ems CmsOur collection
    KB208 (lap)lap insertion mutant; Emr (5 μg/ml)32
    CKB208 (lap+)lap complementation of KB208; Emr (5 μg/ml) Cmr (5 μg/ml)32
    AKB301 (ΔinlA)inlA deletion mutantThis study
    AKB302 (inlA+)inlA complementation of AKB301; Cmr (5 μg/ml)This study
Caco-2 cell line
    HTB37Wild type; Geneticin (G418) sensitiveATCC
    shRNA-hsp60 (Hsp60)Stable suppression of hsp60 mRNA; Geneticin (G418 resistant (800 μg/ml)This study
    pCDNA3.1-hsp60 (Hsp60+)Constitutive overexpression of hsp60; G418 resistantThis study
Plasmids
    pGEM-T EasyCloning vectorPromega
    pAUL-ATemperature-sensitive shuttle vector11
    pMGS101Expression vector22
    SureSilencing shRNA-HSPD1Short hairpin RNA against human hsp60SABiosciences
    pCDNA3.1Mammalian expression vectorInvitrogen
    pOTB7-hsp60Mammalian cloning vectorOpen Biosystems
Primers
    inlA primers
        InlAUSFCGGGATCCTACTGCAAGAACAGTTAA (BamHI)This study (NCBI accession no. NC_002973)
        InlAUSRCCATCGATATATAGACTCCT (ClaI)This study (NCBI accession no. NC_002973)
        InlADSFCCATCGATAAGTAGTGTAAAGAGCTA (ClaI)This study (NCBI accession no. NC_002973)
        InlADSRCGGAGCTCATAACTTTGTCACATTGGGTA (EcoRI)This study (NCBI accession no. NC_002973)
        InlABamFCGCGGATCCGTGAGAAGAAAACGATA (BamHI)This study (NCBI accession no. NC_002973)
        InlASphRCGCGCATGCCTATTTACTAGCACGTG (SphI)This study (NCBI accession no. NC_002973)
    hsp60 primer201-bp productSABiosciences
    18S rRNA primers198-bp product
        18SFTCAACTTTCGATGGTAGTCGCCGT2
        18SRACTCATTCCAATTACAGGGCCTCG2
  • a The underlined represents an engineered sequence restriction site with the enzyme name in parentheses. Em, erythromycin; Cm, chloramphenicol.