TABLE 1.

Primers for cloning experiments

Primer no.Sequence (5′ to 3′)a
34GGCATAAATTCCGTCAGC
35TGATGACGAGCGTAATGG
123TTCACCGTCGACAGCCAAGCAATCGCTACG
124TTCACCTCTAGAAGCCTTATTCACGCATCC
125TTCACCTCTAGATAATAAGCGATTTAATTGCGGTAG
126TACGCCGTCGACCATTCATAACCCGTTCACG
127TGATTCTGTCCGTAGAGC
128TCAGCGAAAGCGAACACC
129AAGGAACGGATTTTGTGG
130TAGCCTCTTTTGACGAGC
AS1GAATTCTGCGTGAATAAGGCTGAGTAAGG
AS2TCTAGATTAACTATCCCTACGTATAATGTTTCG
  • a Boldface, added 5′ DNA; underlined, added restriction site.