TABLE 1.

Oligonucleotide primer sequences

PrimerGenebExptDirectionSequencea
P1oppAPCR/sequencingForward5′ ATGAAAAAAACGAAGTTATTTGCC 3′
P2oppAPCRReverse5′ TCAATTCGCTGTTGTCGTATC 3′
P3oppART-PCRForward5′ AATCAGGCATCGGTCATCTC 3′
P4oppART-PCRReverse5′ TCAGTCGTGATAGGCTGTGC 3′
P5oppASequencingForward5′ GGGATGCTGACAATGTTC 3′
P6oppASequencingForward5′ TGTCATTGAAACCGAGACC 3′
P7oppACloningForward5′ ATCGCCATGGAAGCAATAATAGCACGACA 3′
P8oppACloningReverse5′ GGTCGGATCCATTCGCTGTTGTCGTATC 3′
P9F1/oppAUSGOverlap extension PCR/colony PCR/sequencingForward5′ TCTGACACGCTATCCTCACGAA 3′
P10F1/oppAUSGOverlap extension PCR/colony PCRReverse5′ TAGTTAGTCACTTGTGATGCTGTCGTGCTATTAT 3′
P11F2/aphA-3Overlap extension PCR/colony PCRForward5′ GCATCACAAGTGACTAACTAGGAGGAATAAATGG 3′
P12F2/aphA-3Overlap extension PCR/colony PCRReverse5′ GCCATGCTTGCATTATTCCCTCCAGGTACTAAAAC 3′
P13F3/oppADSGOverlap extension PCR/colony PCRForward5′ GGGAATAATGCAAGCATGGCAAAGTGAAAAATCG 3′
P14F3/oppADSGOverlap extension PCR/colony PCRReverse5′ CACAAGCCCTTCTGGTGATT 3′
P15oppAColony PCRForward5′ AAGACTTTGGGCAAATGGTG 3′
P16oppAColony PCRReverse5′ TCAGTCGTGATAGGCTGTGC 3′
P17oppAUSG/F1SequencingForward5′ AAGGAGAAGTAGCAAGGAGG 3′
P18aphA-3/F2SequencingForward5′ GAAGATGAACAAAGCCCTG 3′
P19oppADSG/F3SequencingForward5′ ACACTTTTACCGCCTTGG 3′
  • a Restriction enzyme sites are underlined. Overlapping regions are shown in bold. Extended sequences complementary to the end of the adjacent gene are shown in italics.

  • b USG, upstream gene; DSG, downstream gene.