TABLE 1.

Strains, plasmids, and oligonucleotides used in this study

Strain, plasmid, or oligonucleotideRelevant characteristics or sequence (5′ to 3′)aReference, source, 5′ position, product size, or restriction site
Strains
    S. mutans strains
        UA159ErmsATCC
        UACA2UA159/ptetASgbpB; ErmrThis study
        UA223UA159/pMM223; ErmrThis study
        UAvicKUA159 ΔvicK::ErmrThis study
    S. gordonii strains
        ChallisErmsH. K. Kuramitsu
        Challis CA2Propagation of ptetASgbpB; ermrThis study
    E. coli strain
        DH5αGeneral cloning and plasmid propagationInvitrogen
Plasmids
    pVA838Ermr cassette source26
    pMM2238 kb; Ermr; ori of E. coli, StreptococcusH. K. Kuramitsu (52)
    pALC20736.41 kb, with TetO/TetR sequenceAmbrose L. Cheung (6)
    ptetASGbpB8.8 kb; Ermr; pMM223 with a 220-bp sequence of gbpB (positions 19 to 260) in the antisense orientation under the control of the TetO/TetR promoterThis study
Primers
    Ptet-5GGAATTCAAGCTTGCATCCCTGCAGEcoRI (53)
    Ptet-6GAAGATCTATTCGAGCTCGGTACCCBglII (53)
    TetFTGT TTT TCT GTA GGC CGT GTPosition 19 of TetO/TetR promoter
    ASGbpBFTCAGCAGTTTTAGTGAGTGGTGPosition 18 of gbpB
    ASGbpBRTTGGTACCCCCAAAGTAGCAGACTGAGCTTPosition 259 of gbpB; KpnI
    CGbpBFCAACAGAAGCACAACCATCAPosition 920 of gbpB
    CGbpBRTGTCCACCATTACCCCAGTPosition 1070 of gbpB
    16SRNA-FCGGCAAGCTAATCTCTGAAA
    16SRNA-RGCCCCTAAAAGGTTACCTCA49
    E1-AscITTGGCGCGCCTGGCGGAAACGTAAAAGAAGErmr cassette from pVA838
    E2-XhoITTCTCGAGGGCTCCTTGGAAGCTGTCAGT
    vicKP1TTACCAGATGCTTTTGTTGCTPosition 268 upstream of vicK to bp 288 of vicK
    vicKP2-AscITTGGCGCGCCTACAGACGGTTTTTCTCCTGTGPosition 268 upstream of vicK to bp 288 of vicK
    vicKP3-XhoITTCTCGAGGTGACCGTTTTTATCGTGTTGPosition 1156 of vicK to bp 421 downstream of vicK
    vicKP4CTCTTGCCGTCTTTCATCAGPosition 1156 of vicK to bp 421 downstream of vicK
    vicRHisF-NcoIAACCATGGAGAAAATTCTAATCGTTGACGA717-bp vicR ORF for His tag fusion
    vicRHisR-XhoIAACTCGAGGTCATATGATTTCATGTAATAAC717-bp vicR ORF for His tag fusion
    SMU.22 (gbpB)TTGACAGCTTATCCTTTAAATG223 bp upstream to position 87
TTTACAGCTGATAATGTTGTCG223 bp upstream to position 87
    SMU.1005 (gtfC)GATGCTAACTCTGGAGAACGA231 bp upstream to position 99
TCCTGAAAGAGAGGTCAAAGTC231 bp upstream to position 99
    SMU.1924 (covR)AGATGTCCTCTACCCATTGAAAAATGG269 bp upstream to position 87 (9)
AACCTCATATCCTTCATGTTGTAATTCTAAAG269 bp upstream to position 87 (9)
  • a Restriction sites are underlined. Erm, erythromycin.