TABLE 2

Primers used in this study

PrimerSequence (5′–3′)aDescription
jf070212.1ATGAAAAAATCAATATTATTTATTTTTCTTTCTGTAGTGTAGGCTGGAGCTGCTTCGForward primer for amplifying estH flanking from pKD13
jf070212.2TTAATAGCACCCGGTACAAGCAGGATTACAACACAAATTCCGGGGATCCGTCGACCReverse primer for amplifying estH flanking from pKD13
jf070212.3ATGAAAAAGCTAATGTTGGCAATTTTTATTTCTGTAGTGTAGGCTGGAGCTGCTTCForward primer for amplifying estP flanking from pKD13
jf070212.4TTAATAACATCCAGCACAGGCAGGATTACAACAAAGATTCCGGGGATCCGTCGACCReverse primer for amplifying estP flanking from pKD13
jf071612.1GGCGCACACAAATATAAAG368-bp amplicon in H10407-estH downstream primer
jf071612.2AGCGGAGAGTATAGTATGAestH upstream
jf071612.3AAAACCAGATAGCCAGAC168 bp upstream from estP on H10407 plasmid p666
k2CGG TGC CCT GAA TGA ACT GCPrimer binding Kmr cassette for confirming estP and tolC deletion
jf072312.1ATGAAAAAATCAATATTATTTATTTTTCTTTCTGTACCCTGTTATCCCTAGATTTForward primer for amplifying estH from pGPS4
jf072312.2TTAATAGCACCCGGTACAAGCAGGATTACAACACAATAACGGTCCTAAGGTAGCReverse primer for amplifying estH from pGPS4
jf072412.5GGCCTCTTGCGGGATATCTAAATGAAAAAATCAATATTApACYC184_ECORV_TAA_STh forward primer for in-fusion cloning
jf072412.6GTCGGAATGGACGATATCTTAATAGCACCCGGTACApACYC184_ECORV_TAA_STh reverse primer for in-fusion cloning
jf060614.2AGGAGATATACCATGGATGAAAAAATCAATATTAForward primer for STh in NcoI and EcoRI sites on pETDuet-1 vector
jf060614.3CGCCGAGCTCGAATTCTTAATAGCACCCGGTACAReverse primer for STh in NcoI and EcoRI sites on pETDuet-1 vector
jf060614.4TACATATGGCAGATCTATGAAAAAGCTAATGTTGForward primer for STp in BglII and XhoI sites on pETDuet-1 vector
jf060614.5CTTTACCAGACTCGAGTTAATAACATCCAGCACAReverse primer for STp in BglII and XhoI sites on pETDuet-1 vector
jf042715.1GATCCGATCCCCGGGTACCGAGCTCGAATAGTAGCAATTACTGCTGTGAATTGTGTTGTAATCCTGCTTGTACCGGGTGCTATTGAG5′-Mature estH gene with BamHI, linker, gene, stop codon
jf042715.2AATTCTCAATAGCACCCGGTACAAGCAGGATTACAACACAATTCACAGCAGTAATTGCTACTATTCGAGCTCGGTACCCGGGGATCG3′-Mature estH gene with linker, gene, stop codon, EcoRI
jf042517.1GATCCGATCCCCGGGTACCGAGCTCGAATAGTAGCAATTACTGCTGTGAATTGTGTTGTAATCCTcaaTGTACCGGGTGCTATTGAG5′-Mutant estH gene with BamHI, linker, gene, stop codon
jf042517.2AATTCTCAATAGCACCCGGTACAttgAGGATTACAACACAATTCACAGCAGTAATTGCTACTATTCGAGCTCGGTACCCGGGGATCG3′-Mutant estH gene with linker, gene, stop codon, EcoRI
jf031915.5GATCCGATCCCCGGGTACCGAGCTCGAACACATTTTACTGCTGTGAACTTTGTTGTAATCCTGCCTGTGCTGGATGTTATTGAG5′-Mature estP gene with BamHI, linker, gene
jf031915.6AATTCTCAATAACATCCAGCACAGGCAGGATTACAACAAAGTTCACAGCAGTAAAATGTGTTCGAGCTCGGTACCCGGGGATCG3′-Mature estP gene with linker, gene, EcoRI
jf021915.1CGCTTACAGACAAGCTGTGReverse sequencing primer that binds 70 bp downstream of the pGEX cloning site
jf021915.2CCAGCAAGTATATAGCATGGForward sequencing primer that binds 117 bp upstream of pGEX cloning site
jf110716.38CGGGCGCAGTCTGTTCTATTGForward primer for amplifying 1,027-bp left-flank segment of H10407 tolC
jf110716.43TCATTTGCATTCCTTGTGGTGAAGCAGTATTTAGCGCReverse primer for amplifying 1,027-bp left-flank segment of H10407 tolC
jf110716.44AAAGGGTTATGTGTAGGCTGGAGCTGCTTCGReverse primer for amplifying Kmr cassette from strain JQ5503-1
jf110716.45CTTCACCACAAGGAATGCAAATGATTCCGGGGATCCForward primer for amplifying Kmr cassette from strain JQ5503-1
jf110716.39CTTTTCAACCTGGGCGAGGGReverse primer for amplifying 985-bp right-flank segment of H10407 tolC
jf110716.46CCTACACATAACCCTTTCCGTAACTGATGACGACGACGGGGCTTCGGForward primer for amplifying 985-bp right-flank segment of H10407 tolC
jf101716.21CGATCGTGATGCTGCCTTTG603-bp amplicon in H10407-tolC forward primer
jf101716.22AGCGACAGGTTGCGTTTTTC603-bp amplicon in H10407-tolC downstream primer
jf112016.50ATTTGCCATTGCTCACCAATAAACForward primer binding 2 kb upstream of H10407 tolC
jf112016.51CTTGCAGACTGTTAAACTGGTCGReverse primer binding 2 kb downstream of H10407 tolC
jf120716.52GAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGForward primer to amplify 4,036 bp of pBAD/myc-His B
jf120716.53GGTTAATTCCTCCTGTTAGCCCAAAAAACGGReverse primer to amplify 4,036 bp of pBAD/myc-His B
jf120716.59GGCTAACAGGAGGAATTAACCATGCAAATGAAGAAATTGCTCCCCATTCTForward primer H10407 tolC gene
jf120716.60CTCTTCTGAGATGAGTTTTTGTTCTCAGTTACGGAAAGGGTTATGACCGTTACTReverse primer H10407 tolC gene
jf092616.1TTTCACCTTTCGCTCAGGATTACAAAGACCACForward bp 44–60 of estH-5′3×FLAG
jf092616.2GAAGACCCTGCTGGTTTAGCCTTGTCATCGTCReverse bp 83–64 of estH-3′3×FLAG
jf092616.3GCTAAACCAGCAGGGTCTTCAAAAGAAAAAATTACAForward primer bp 64–99 of estH
jf092616.4ATCCTGAGCGAAAGGTGAAAAAGATAATACAGAAAGAReverse primer bp 63–27 of estH
jf092616.5CTGCTTGTACCGGGTGCTATGATTACAAAGACForward primer bp 197–216 of estH-5 3×FLAG
jf092616.8ATAGCACCCGGTACAAGCAGGATTACAReverse primer representing bp 216–190 of estH
jf092616.9GATTACAAAGACCACGATGGTGACTATAAAGACCATGATATCGBase pairs 1–43 and 66 through 19 of the 3×FLAG-encoding sequence
jf092616.10CTTGTCATCGTCGTCTTTATAATCGATATCATGGTCTTTATAGTCACC
jf101916.31CAGATCTGGTACCCGGGAATTCTFor amplifying pFLAG-CTC vector backbone
jf101916.32TGAAGATCGATCTCTCGATCGAGTGA
jf101916.33ATTCCCGGGTACCAGATCTGATGAAAAAATCAATATTATTTATTTTTCTTTCTGTATTForward primer beginning with pflag-CTC- sequence followed by estH sequence bp 1–38
jf101916.34GATCGAGAGATCGATCTTCATTAATAGCACCCGGTACAAGCAGGReverse primer beginning with pflag-CTC sequence followed by 3′estH native reverse sequence (bp 219–196)
jf101916.35GATCGAGAGATCGATCTTCATTACTTGTCATCGTCGTCTTTATAATCGATATCATGReverse primer beginning with pflag-CTC-sequence followed by bases 69–34 of the 3×FLAG sequence
jf092313.5TCTTTCCCCTCTTTTAGTCAGestP RT-PCR forward primer
jf092313.6ACAGGCAGGATTACAACAAAGestP RT-PCR reverse primer
jf092313.7TACAAGCAGGATTACAACACestH RT-PCR forward primer
jf092313.8AGTGGTCCTGAAAGCATGestH RT-PCR reverse primer
jf092210.1ATCAATCTGCCGGGTAAGAACGGTarcA RT-PCR forward primer
jf092210.2TCCAGATCACCGCAGAAGCGATAAarcA RT-PCR reverse primer
jf030316.3TGGATGCGAGCTCGAGCATGAAAAAGCTAATGTTGestP forward primer for pBAD/mycHisA-STp cloning
jf060614.1AGCTGCAGATCTCGAGTTAATAACATCCAGCACAestP reverse primer for pBAD/mycHisA-STp cloning
  • a See “Description” column for explanation of underlined bases.