TABLE 2

Primers used in this study

Primer namePrimer sequence (5′ to 3′)
IL-8 (RT)-FTCGAGACCATTTACTGCAACAG
IL-8 (RT)-RCATTGCCGGTGGAAATTCCTT
p65 (RT)-FTGCGATTCCGCTATAAATGCG
p65 (RT)-RACAAGTTCATGTGGATGAGGC
β-actin (RT)-FGTGACGTTGACATCCGTAAAGA
β-actin (RT)-RGCCGGACTCATCGTACTCC
p65-FATGGACGATCTGTTTCCCCTC
p65-RTTAGGAGCTGATCTGACTC
Flag-p65-FCCATAGAAGATATGGACGATCTG
Flag-p65-RGATTTAAATTCTTACTTGTCGTCATCGTCTTTGTAGTCGGAGCTGATC
p65 (S276A)-R1CGCGATCAGCAGGCCGC
p65 (S276A)-F2GCGGCCTGCTGATCGCG
OspF-HA-FCCATAGAAGATATGCCCATAAAAAAGCCCTGTC
OspF-HA-RGATTTAAATTCCTAGGCATAGTCTGGGACGTCA
OspF(K102R)-FGGGGACAGGTTTCATATTAG
OspF(K102R)-RCTAATATGAAACCTGTCCCC
OspF(H104A)-FGACAAGTTTGCTATTAGTA
OspF(H104A)-RTACTAATAGCAAACTTGTC
OspF(K134A)-FGATAAATGGGCGATAACTG
OspF(K134A)-RCAGTTATCGCCCATTTATC
OspF-EGFP-RCTCGCCCTTGCTCACGGCATAGTC
EseH-EGFP-FCTGTTTTGTCTAGAATGCCCC
EseH-EGFP-RCCTTGCTCACGCTAGCCTCTGT
line-pCDH-FATCTTCTATGGAGGTCAAAACAGC
line-pCDH-RGAATTCGAATTTAAATCGGATCCG
line-pCDH-EGFP-FGTGAGCAAGGGCGAG