TABLE 1.

Oligonucleotide primers for quantitative real-time PCR

GeneORFSequence a
ForwardReverse
gapA c2184AAGTTGGTGTTGACGTTGTCGCAGCGCCTTTAACGAACATCG
btuB c4929TTGCGCCAACTACTGTTGTGACACATGACTGGCATTTGTACCGC
Tsx c0521ACGACAAACCGCAGTATCTTTCCGAGCGAATGCTTCGTACTCAAGG
tolC c3781AATGAAGCGCGCAGTCCATTACTTAACGCACGCCATTTCGAC
tonB c1717TGCATTCATGGTGCTGTTGTGGTTGTGGCGGTTCAAGATCAG
irgA c5174TCCTGTGGAAGCAATTGAACGCAAGTACGCCATCCCATGTTTGG
iha c3610TGCGAATAACCACTCTGGCTTCTAATCACAGAAACACTGGCGGC
NA bc2482ATCGTTCGGCAAGCAACCTTTGATGCGGATTTGTTTACGGCCTG
iroN c1250ATTACCAAACGTCCCACCAACGAAACGCGTGGTAAGAGCATCAC
fhuA c0185ACGGCCAAAGCCAGAATAACTTACCGTAAAGCACGGAAACCG
fepA c0669ATTGATATTCGCGGCATGGGTCACGTTCAATCATTTCAGGCGGC
iutA c3632AAAGAGCTGAAAGACGCACTGGTGTCGGAACGTGAAGAGTTGAG
chuA c4308AGCGTGTTGAGATTGTTCGCAAACCACTGCTTTGTCCTTCCTGC
cirA c2690AAAGAAGTGCCTGGCGTACAACAAATCATTGTGGCGGAAGACGG
  • a Primer sequences are listed from 5′ to 3′.

  • b NA, no gene name available.