TABLE 1.

Oligonucleotide primers for quantitative real-time PCR

GeneORFSequence a
ForwardReverse
gapAc2184AAGTTGGTGTTGACGTTGTCGCAGCGCCTTTAACGAACATCG
btuBc4929TTGCGCCAACTACTGTTGTGACACATGACTGGCATTTGTACCGC
Tsxc0521ACGACAAACCGCAGTATCTTTCCGAGCGAATGCTTCGTACTCAAGG
tolCc3781AATGAAGCGCGCAGTCCATTACTTAACGCACGCCATTTCGAC
tonBc1717TGCATTCATGGTGCTGTTGTGGTTGTGGCGGTTCAAGATCAG
irgAc5174TCCTGTGGAAGCAATTGAACGCAAGTACGCCATCCCATGTTTGG
ihac3610TGCGAATAACCACTCTGGCTTCTAATCACAGAAACACTGGCGGC
NA bc2482ATCGTTCGGCAAGCAACCTTTGATGCGGATTTGTTTACGGCCTG
iroNc1250ATTACCAAACGTCCCACCAACGAAACGCGTGGTAAGAGCATCAC
fhuAc0185ACGGCCAAAGCCAGAATAACTTACCGTAAAGCACGGAAACCG
fepAc0669ATTGATATTCGCGGCATGGGTCACGTTCAATCATTTCAGGCGGC
iutAc3632AAAGAGCTGAAAGACGCACTGGTGTCGGAACGTGAAGAGTTGAG
chuAc4308AGCGTGTTGAGATTGTTCGCAAACCACTGCTTTGTCCTTCCTGC
cirAc2690AAAGAAGTGCCTGGCGTACAACAAATCATTGTGGCGGAAGACGG
  • a Primer sequences are listed from 5′ to 3′.

  • b NA, no gene name available.