TABLE 4

Primers and probes used for detection of the vector, Rickettsia species, and host

Primer set or probeSequencea (5′–3′)Partial gene amplifiedReference or source
Rr190.70ATGGCGAATAATTCTCCAAAARickettsia sp. ompA45
Rr190.701GTTCCGTTAATGGCATCT46
R.and957FCGCTGGACAAGTTTATGCTCAAGCa. Rickettsia andeanae” ompB44
R.and1062RGGCAGTAGTACCGTCTGTACCAC
R.and1003FAM–CGCGATGAGGCGGACAGGTAACTTTTGATCGCG–BHQ-1
RpompB129FCAAATGTTGCAGTTCCTCTAAATGR. parkeri ompB44
RpompB224RAAAACAAACCGTTAAAACTACCG
RpompBFAM–TTTG+A+G+C+A+G+AC–IABKFQb12
A.macMIF.18FCCAGGGCCTTCTCGATGTA. maculatum MIF7
A.macMIF.99RCCATGCGCAATTGCAAACC
A.macMIF.63HEX–TGTTCTCCTTTGGACTCAGGCAGC–BHQ-1
Ratcfd121FGCTTCAGTGCAAGTGAATGGRat cfd50
RatcfdRevTGCCACTCACACTCCATCCThis paper
RatcfdHexHEX–TGGATGAGCAGTGGGTGCTGA–BHQ-1This paper
  • a FAM, 6-carboxyfluorescein; BHQ-1, black hole quencher; IABKFQ, Iowa Black dark quencher; HEX, hexachlorofluorescein.

  • b A plus sign denotes the use of a locked nucleic acid.