TABLE 1

Oligonucleotides used in this study for the transfection of GFP constructs and quantification of gene expression or parasite burden

PrimerOligonucleotide (5′–3′)Application
TLR3 forwardATGAAAGGGTGTTCCTCTTATCTransfection assay
TLR3 reverseATGTGCTGAATTCCGAGATCCTransfection assay
IRF3 forwardATGGAAACCCCGAAACCGTransfection assay
IRF3 reverseGATATTTCCAGTGGCCTGGTransfection assay
IFN-α forwardTGTCTGATGCAGCAGGTGGGene expression
IFN-α reverseAAGACAGGGCTCTCCAGACGene expression
IFN-β forwardAAGAGTTACACTGCCTTTGCCATCGene expression
IFN-β reverseCACTGTCTGCTGGTGGAGTTCATCGene expression
GAPDH forwardCTCGTCCCGTAGACAAAATGGqPCR
GAPDH reverseAATCTCCACTTTGCCACTGCAqPCR
Nc5 forwardGCTGAACACCGTATGTCGTAAAqPCR
Nc5 reverseAGAGGAATGCCACATAGAAGCqPCR