TABLE 2

Primers used in this study

Target or groupNameSequence (5′ to 3′)Location (GenBank accession no.)
secA2E.iTCGGATCCAGAATTCTCAGATTGCAGAAATGAGAACa944658–944678 (CP034442)
E.iiCACGAACGAAAATCGATCTGGATCATAGGCATTCTGb944102–944122 (CP034442)
E.iiiATAAACCCTTGCATAATTCATTTGACCTCTCGTCGb943218–943237 (CP034442)
E.ivCTTGTCGACGAATTCAACAGTCATCTATCGCTCTCa942780–942800 (CP034442)
E.5ACTAAACGATTCAATTTGAC944931–944950 (CP034442)
E.6TAATGTAACTCAATGCCATG942610–942629 (CP034442)
fapAA.1ATTTGATGCGGACGAATATC933128–933147 (CP034442)
A.3TAGGTTTCATTGACTGTATC932764–932783 (CP034442)
A.4TGAGGTTTGTTCAAGGAGTGG932645–932665 (CP034442)
A.2AGTAACTGTTAATCCAAGAGC932253–932273 (CP034442)
A.5GGTGTTCCTTTCTCGG933173–933188 (CP034442)
A.6AGTTAAGCTGTCCAGCTTCG932123–932142 (CP034442)
A.7ACCTGCTGTAACGTATGATG932834–932853 (CP034442)
A.8TAGCATTTCTAGCATCTTGC932711–932730 (CP034442)
A.9AAGGAGCAAGAACCAGCAAAAC917963–917984 (CP034442)
A.10TTGTGAGAATGGCGATGAGAAT917838–917859 (CP034442)
fapBB.1TGCAGGATTTGTGATGACTC1826328–1826347 (CP034442)
B.3GCAGGGTTGACCTTAAGGTTG1826847–1826867 (CP034442)
B.4AGCAACAATATCGCAGCTGG1826944–1826963 (CP034442)
B.2TCCGTACTTGCACAACATCC1827339–1827358 (CP034442)
B.5TCTAGTACCCTATCAGACAC1826236–1826255 (CP034442)
B.6ATTGACCACTCCTTGACCAC1827464–1827483 (CP034442)
B.7ACAAGCGCAGCTCTTAGCAC1826905–1826924 (CP034442)
B.8AATACACCAGCTTCAGAGTC1827103–1827122 (CP034442)
B.9AGCTACATCAAGCGTCTCCATG1841859–1841880 (CP034442)
B.10CGAACTTTGTGAGCCAAGATTG1841995–1842016 (CP034442)
fapCC.1ACCTAGCAGCTGGTGTGATC761428–761447 (CP034442)
C.3TTGTTTAGCAGTGACTTCTG761053–761072 (CP034442)
C.4TATTGTGTACGCAGGAGACG760059–760078 (CP034442)
C.2AACGGCTGCTAATATACGTG759619–759638 (CP034442)
C.5ATCCCTTGATGTCAAGACTG761538–761557 (CP034442)
C.6TAGTAATCGTATCCGTAGTC759513–759532 (CP034442)
C.7TTTCAGCTGAAAGATTGGTC761010–761029 (CP034442)
C.8ACCTTGAAATTGACTCAGCTG761178–761198 (CP034442)
C.9GGGTGTGGAAGGCTATGTTGAG745835–745856 (CP034442)
C.10CGCTGTGGTCTCTGGGAAGAT745748–745768 (CP034442)
C.11GGTCGTGGGATCCCAGTGGATGCTGTTCCAGTTCCAAGc760130–760152 (CP034442)
CG.12GCCTTATCCGTTGCTACTGCATTCTCTTGCCAACTATTTCTACCATTTTd759782–759830 (CP034442)
CG.13AAAATGGTAGAAATAGTTGGCAAGAGAATGCAGTAGCAACGGATAAGGCd759782–759830 (CP034442)
CM.12GCCTTATCCGTTGCTACTGCATTCATTTGCCAACTATTTCTACCATTTTd759782–759830 (CP034442)
CM.13AAAATGGTAGAAATAGTTGGCAAATGAATGCAGTAGCAACGGATAAGGCd759782–759830 (CP034442)
C.14ATGCGGCCGCTCGAGTTATTAGAAAGTTTTATAGTAATCGc759502–759521 (CP034442)
C.15AGTAGCAACGGATAAGGCTG759780–759799 (CP034442)
C.16TTGCCAACTATTTCTACCAT759808–759827 (CP034442)
C.17GGTCGTGGGATCCCAGCTCAACCTGCTCCTTCAGTc761648–761667 (CP034442)
aad9S.FCGATTTTCGTTCGTGAATAC5418–5399 (KM009065)
S.RTATGCAAGGGTTTATTGTTTTC4265–4286 (KM009065)
ermE.FCTCGAGCGGCCGCCAGTG264–282 (EU233623)
E.RAACGGCCGCCAGTGTGCTG319–336 (EU233623)
JanusJ.FCCGTTTGATTTTTAATGGATAATG773–796 (AF411920.1)
J.RGGGCCCCTTTCCTTATGCTT2105–2086 (AF411920.1)
rpsLR.FCGGTACTTTTTACTTTTGGTCTCTC1709537–1709561 (CP034442)
R.RTCTTTATCCCCTTTCCTTATGC1710075–1710096 (CP034442)
rpoBRP.FAARYTIGGMCCTGAAGAAAT1682613–1682632 (CP034442)
RP.RTGIARTTTRTCATCAACCATGTG1683330–1686352 (CP034442)
aroEAR.FGCCTTTGAGGCGACAGC1232187–1232203 (NC003098)
AR.RTGCAGTTCARAAACATWTTCTAA1231725–1231747 (NC_003098)
pGEXG.FGGGCTGGCAAGCCACGTTTGGTG869–891 (M97937)
G.RCCGGGAGCTGCATGTGTCAGAGG1018–1040 (M97937)
CBM40F.FAAGTTCTGTTTCAGGGAGTGATAGAAAAAGAAGATGe1525205–1525223 (NC_008533)
F.RGTCTAGAAAGCTCTAACTACGTTTTTGTACCTCTTCe1524669–1524689 (NC_008533)
  • a Underlining indicates nucleotides introduced to allow in-fusion cloning into the pDrive vector.

  • b Underlining indicates nucleotides introduced to allow in-fusion cloning with aad9 (spectinomycin resistance cassette).

  • c Underlining indicates nucleotides introduced to allow in-fusion cloning with the pGEX-5X-3 vector.

  • d Bold indicates the nucleotides altered to introduce the amino acid substitution.

  • e Underlining indicates nucleotides introduced to allow in-fusion cloning with the pOPINF vector.