Table 1.

Primers and probes used for RT-PCR

GeneForward primerReverse primerProbe
clfBTTCCAATGCGCAAGGAACTAGCAGCATTTACTACAGGTTCAGCAACTAGACTACGTACAGCTCTCGTTCTAACACTT
gyrBCAAATGATCACAGCATTTGGTACAGCGGCATCAGTCATAATGACGATAATCGGTGGCGACTTTGATCTAGCGAAAG
hlaAAAAAACTGCTAGTTATTAGAACGAAAGGGGCCAGGCTAAACCACTTTTGCCTTCTTCGCTATAAACTCTATATTGACCAGCAAT
rnaIIIGTGATGGAAAATAGTTGATGAGTTGTTTGAATTTGTTCACTGTGTCGATAATCCTGCACAAGATATCATTTCAACAATCAGTGACTTAGTAAAA
sdrDTCAGATGAGCAAGCTTCACCAATTGGTTGAGCATTTACCACTGATTATTCTCTTGCAAATCAGGTTGTAACGCTTCTTG
rotATTTTGCAATTAGAAACACTTTTGGTCTTCTCTAGACATTTTGTATTCGCTTTTGACATTAACTCAATTTTCAGCGAGATTG
sarH1CCACCATAAATACCCTCAAACTGTTTCATCTTCAGTTGAGCGTTCTTTTAGCTCTCAATAATTTAAAAAAGCAAGGCTA
sdrCCAACTGCAGATCAGCCTAAAGTGATGGTGATTGCATGTTACTACTAGTTTCTTTGAGTGATAGTGCAACAGTT
clfAAGGTTCTGGTGACGGTATCGATCAATTTCACCAGGCTCATCAGAAACCAGTTGTTCCTGAAC
efbTTTAACGATGGTACATTCGAATATGGATCAGTTTTCGCTGCTGGTTTATCACGTCCACAATTT
mecATTCCACATTGTTTCGGTCTAAAATTAATGCAGAAAGACCAAAGCATACACCACGTTCTGATTTTAAA
arcA1TGCGATCGTATGTCACCACAACAATGGAATGATGGCTCAAACACCTGGTCGAATACATAAT
arcA2TCAGCTGCTAACTTCTCAAGGTAAAGCATTTTGCGCAGGTGCTAAGACTTCAACACCCTCTTC
spaCAGCAAACCATGCAGATGCTAGCTAATGATAATCCACCAAATACAGTTGCATTACCAGAAACTGGTGAAGAAAATCCATTCATTG