Table 1

Primer sets used to quantitate gene expression by quantitative RT-PCRa

Host and cytokine or geneForward primer (5′–3′)Reverse primer (5′–3′)Reference or source
Zebrafish
    β-ActinTGCTGTTTTCCCCTCCATTGTTCTGTCCCATGCCAACCARojo et al. (32)
    IL-1βTGGACTTCGCAGCACAAAATGGTTCACTTCACGCTCTTGGATGWatzke et al. (43)
    IL-12TCTAACTTCAGCGCAGTGGATGCGGTGGTGTAGTGAGTGIto et al. (17)
    IFN-γCTTTCCAGGCAAGAGTGCAGATCAGCTCAAACAAAGCCTTTCGCTVojtech et al. (42)
    TNF-αGATGGTGTCCAGGAGGAAAGCAGAGTTGTATCCACCTGTTIto et al. (17)
M. marinum
    secA2GTGGGTCAACTCGTCAAACTCTTCGGAGTACAGATCGAThis work
    sodAACAAGCTGCTGATCTTCCAGGTCTTGGCGAAGTCGACCTTCACATTCTThis work
  • a These primers were used for quantitative RT-PCR using QuantiFast SYBR Green. Sequences for all zebrafish cytokine primers were obtained from published studies, while those for M. marinum were developed here.