Table 1

Relevant bacterial strains, plasmids, and primers used in this study

Strain, plasmid, or primerDescriptiona or sequence (5′–3′)Source or reference
E. coli strains
    CFT073Wild-type pyelonephritis isolate38
    fim L-ONCFT073 fim IE phase locked ON; constitutive type 1 fimbrial expression19
    fim l-OFFCFT073 fim IE phase locked OFF; blocking type 1 fimbrial expression19
    ΔmutS mutantCFT073 ΔmutS:Kanr49
    ΔmutH mutantCFT073 ΔmutH:KanrThis study
    ΔmutL mutantCFT073 ΔmutL:CamrThis study
    fim L-ON ΔmutSCFT073 fim L-ON ΔmutS:Kanr49
    fim L-ON ΔmutHCFT073 fim L-ON ΔmutH:KanrThis study
    fim L-ON ΔmutLCFT073 fim L-ON ΔmutL:KanrThis study
Plasmids
    pGEN-MCSDerivative of pGEN222 with a multiple cloning site replacing gfpuv (Ampr)31
    pGEN-mutSCFT073 mutS cloned into BamHI-SphI sites of pGEN-MCS (Ampr)49
    pGEN-mutHCFT073 mutH cloned into EcoRI-HindIII sites of pGEN-MCS (Ampr)This study
    pGEN-mutLCFT073 mutL cloned into EcoRI-HindIII sites of pGEN-MCS (Ampr)This study
Primers
    Invertible element
        IE-P1 fowardAGTAATGCTGCTCGTTTTGC
        IE-P2 reverseGACAGAGCCGACAGAACAAC
    Mutant construction
        mutS H1P1TGAAAGCCCAGCATCCCGAGATCCTGCTGTTTTACCGGATGTGTAGGCTGGAGCTGCTTC
        mutS H2P2TGCCGTGCGCGCTTAATAACCTCTTTTGGCACACCCGCCAATGGGAATTAGCCATGGTCC
        mutH H1P1ATGTCCCAACCTCGCCCACTGCTCTCTCCTCCCGGTGTAGGCTGGAGCTGCTGCTTC
        mutH H2P2ATCCGTTCGCCCCGGGCACCAATAGCTTCGGTCAGCATGGGAATTAGCCATGGTCC
        mutL L-ON H1P1GGGTGCAACGGCACAAACGGCCAGTACGGTGACGACGGTGTAGGCTGGAGCTGCTTC
        mutL L-ON H2P2GCGGACATAACCGTTCCACGTCCGCCAGCAGGGATGGGAATTAGCCATGGTCC
        mutL H1P1ACCGCCACAACTGGCGAACCAGATTGCCGCAGGTGTAGGCTGGAGCTGCTTC
        mutL H2P2TGGCCTGTGCCATTGACCACTGCGCATGTTCGCATGGGAATTAGCCATGGTCC
    Mutant screen
        mutS forwardCCCGAGATCCTGCTGTTTTA
        mutS reverseTGCGCGCTTAATAACCTCTT
        mutH forwardGTTACACTGCGAATATTCAGC
        mutH reverseCAATCCTAGCCAATAGGTACG
        mutL forwardGATGCAATCTGCGCCGCAGG
        mutL reverseCAGCTCAATGGCTAACGCCG
    Mutant complementation
        pGEN-MCS forwardACTTGCTCACGCTCTGTCAT
        pGEN-MCS reverseAGAAGGACCATGTGGTCACG
        mutS forwardCAGCATGCGGACATGCTGCCTCCATACT
        mutS reverseTGGATCCAGCAAAAGGCTATCGGGAAT
        mutH forwardATATATGAATTCGGATAACATGGTGTAAGATCCTGTT
        mutH reverseGTGCTGTGGGAAGCTTTGCCACCAC
        mutL forwardATATATGAATTCGTTCTGCGTTCGCCGGATATTCCG
        mutL reverseATATATAAGCTTCTGCGACGGATCGCGAATATTCAG
    Sanger sequencing
        mutH forwardGGCCGATACAAACCGGCTTCGTGTC
        mutH reverseCGCCATGACGTAATCACTGGAACAC
        mutL forwardGTACCTTGCTCAAT
        mutL reverseCGAACTGATGCAC
        Pap promoter forwardGCGTGAAGAGTATTTCCGGGCC
        Pap promoter reverseCCATAGCTACCGCACCGGCA
        FlhDC promoter forwardTCTGTGAACTTCAGGTGAC
        FlhDC promoter reverseTCAGCAACTCGGAGGTATGC
    qPCR
        gapA forwardAAGTTGGTGTTGACGTTGTCGC
        gapA reverseAGCGCCTTTAACGAACATCG
        fliC fowardACAGCCTCTCGCTGATCACTCAA
        fliC reverseGCGCTGTTAATACGCAAGCCAGA
        fimA forwardACTCTGGCAATCGTTGTTCTGTCG
        fimA reverseATCAACAGAGCCTGCATCAACTGC
  • a Camr, chloramphenicol resistance; Ampr, ampicillin resistance; Kanr, kanamycin resistance.