Table 2

Primers used in the study

Primer purpose and nameSequence
Construction of deletion mutants
    carAB forwardGAGTGAATATTCTCTGGAGGGTGTTTTGATTAAGTCAGCGTAATGTGTAGGCTGGAGCTGCTTCG
    carAB reverseCAGGGTGGTGTCGTAATGCACTTTATATTGCAGCGCACTGCCATATGAATATCCTCCTTA
    argE forwardGGGTGATCAGTTCGCGGGTGGGCTTGATAAACCTCGTCTCTAATGTGTAGGCTGGAGCTGCTTCG
    argE reverseTACCGCCATTTATCGAGATTTACCGTGCTCTGATTGCCACATATGAATATCCTCCTTA
    argC forwardTTCAGCGCAAAGCAATGATGCGGGAAAGTTAATCTCCGATTAATGTGTAGGCTGGAGCTGCTTC
    argC reverseGCACCGCTTGTGCCGCCGCGCCTTTCAGTAAGTTGTCTTCCATATGAATATCCTCCTTA
    purA forwardGACTGAACGGGCTAAATATGTTGTACGCTACCAGGGCGGTTAATGTGTAGGCTGGAGCTGCTTC
    purA reverseACGCGTCGAACGGGTCGCGCAGAATCATGGTTTCAGTACCATATGAATATCCTCCTTA
    metE forwardTATTGGGCGGGGAACTCCACGCGTGAAGAACTGCTGTAATGTGTAGGCTGGAGCTGCTTCG
    metE reverseGGCCAGCCGCGCGTTTTCAGGCCACAGTCCGGGTTGACCCCATATGAATATCCTCCTTA
    ilvA forwardAAGAGCGGTACTACGTGCACCGGTTTACGAGGCGGCGCAGGTCTAATAGGCTGGAGCTGCTTCGAA
    ilvA reverseGGTCGCCAAGTTCGAACGCCGCCAGTACGCGCCCGTAGTCCATATGAATATCCTCCTTA
    ilvC forwardCAGGGTAAAAAAGTAGTCATCGTCGGCTGTGGCGCACAGTAATGTGTAGGCTGGAGCTGCTTCG
    ilvC reverseAGCCGCGCAGTTTCTTACCTACCTGCTCAATCGCATGGCATATGAATATCCTCCTTA
Verification of deletion mutants
    dapATGCGAGATGTGCTTGATCT
    carBCATCGGCATTCAGCGCCAT
    yijPGTTTAGCCTGGACTTCTGTG
    argBACGCCACCCAGTTTGATAA
    yjeTTGAATTCGACAATCTGGCTG
    yjeBTCACTCCACCAGCAATAATT
    yigMGTCAACCTGATACTTCGCTA
    metETGCACCATGTTCGCCAGTG
    ilvCTAACCCGCAACAGCAATACG
    k1, pKD4 (reference)CAGTCATAGCCGAATAGCCT
    k2, pKD4 (reference)CGGTGCCCTGAATGAACTGC
    kt, pKD4 (reference)CGGCCACAGTCGATGAATCC
Complementation
    carAB forwardCGGCGGATCCGCTAACAGGAGGAATTAACCGTGAGTGAATATTCT
    carAB reverseGCGCGTCGACTTATTTGATCTGCGC
    argE forwardCGGCGGATCCGCTAACAGGAGGAATTAACCATGAATATTGATACT
    argE reverseGCGCGCATGCTTAATGCCAGCAAAA
    argC forwardCGGCGGATCCGCTAACAGGAGGAATTAACCATGTTGAATACGCTG
    argC reverseGCGCGTCGACTTAAATAAGAGACTG
    purA forwardCGGCGGATCCGCTAACAGGAGGAATTAACCATGGGTAACAACGTC
    purA reverseGGCGGTCGACTTACGCGTCGAACGG
    metE forwardCGGCGGATCCGCTAACAGGAGGAATTAACCATGACAATTCTTAAT
    metE reverseGCCGGTCGACTCATCCCCGACGCAA
    ilvA forwardCGGCGGATCCGCTAACAGGAGGAATTAACCATGATGGCAGACTCA
    ilvA reverseGCGCGTCGACTTAACCCGCCAAAAA
    ilvC forwardCGGCGGATCCGCTAACAGGAGGAATTAACCATGGCTAACTACTTC
    ilvC reverseGCGCGTCGACTTAACCCGCAACAGC