Table 2

Primer sequences

PrimerSequence
crp KOa
    ForwardGCGCATGGTGCTTGGCAAACCGCAAACAGACCCGACTCTCTGTGTAGGCTGGAGCTGCTTCG
    ReverseCGCGCTACCAGGTAACGCGCCACTCTGACGGGATTAACGACATATGAATATCCTCCTTAG
crp KO confirmation
    ForwardGTATGCAAAGGACGCCACAT
    ReverseTTCGCCAAGCATTAACCCAA
cyaA KO
    ForwardGCGGAATCACAGTCATGACGGGTAGCAAATCAGGCGATACTGTGTAGGCTGGAGCTGCTTCG
    ReverseTACTGCTGCAACAGCGGCGCGTCATGCTCCTGATTGGCAGCATATGAATATCCTCCTTAG
cyaA KO confirmation
    ForwardAACCAGGCGCGAAAAGTGGT
    ReverseCTGAAAGGCGACGAGTGGAT
otsBA KO
    ForwardATGTCTGTAAAGCGCGTTCTGCGCAACACAATAAGAAATGTGTAGGCTGGAGCTGCTTCG
    ReverseCTACGCAAGCTTAGGAAAGGTAGCAACTTTATCGCGCTGCCATATGAATATCCTCCTTAG
otsBA KO confirmation
    ForwardAGCGAAACGCACTGTCTGAT
    ReverseTTGCCTACGGTGAGTTAAGC
dps KO
    ForwardTTATTCGATGTTAGACTCGATAAACCACAGGAATTTATCCAGGTCGCGAGCACCAAACACCCCCCAAAACC
    ReverseGTGATAGGAACAGCCAGAATAGCGGAACACATAGCTGGTGCTATACTTAGCACACAACCACACCACACCAC
dps KO confirmation
    ForwardGATAGCAGATGGATGCACTA
    ReverseTGACAGTACGCAAAGAGAGC
rpoS KO
    ForwardCCAGCCTCGCTTGAGACTGGCCTTTCTGACAGATGCTTACCACCAAACACCCCCCAAAACC
    ReverseTGCCGCAGCGATAAATCGGCGGAACCAGGCTTTTGCTTGACACACAACCACACCACACCAC
rpoS KO confirmation
    ForwardAATGATGATTGCCGAATGTGACGCTG
    ReverseGCATTGTGTCGTTATGGGCGTAGG
pcrp
    ForwardCCCCC CTGCAG ATGGTGCTTGGCAAACCGCA
    ReverseCCCCC GGTACC TTAACGAGTGCCGTAAACGA
pcyaA
    ForwardCCCCC CTGCAG TTGTACCTCTATATTGAGAC
    ReverseCCCCC GGTACC TCACGAAAAATACTGCTGCA
prpoS
    ForwardCATTC CTGCAG ATGTTCCGTCAAGGGATCA
    ReverseAGTGC AAGCTT TTATTCGCGGAACAGCGCT
pRR48 sequencing primer
    ForwardCTGCTGAAGAGTACTTTGG
    ReverseCCAAAGCTGAAGACATCCAG
  • a KO, knockout.