Table 3

Primers used for quantitative RT-PCR

GenePrimer sequence
ForwardReverse
aceAAGATGTCTTGGGTGTACCAACGCTAGCAGTACGGTCGCCGGTAATAAA
agaZGTGCAGCCTGGTGTTGAGTTTGATAATCGGTGGAGTGGGCTTCGAATA
caf1AACTTTACAGATGCCGCGGGTGATAGCGAACAAAGAAATCCTGGCTGC
deoBATCTGCCGGGCTATTTGGGTAACTGGGCAATTTCGCACAGCTCATACA
fruKGATCAACGTTGCCAAGGTGCTGAAAGTCACTTCGCCATCTTTCTCGGT
galTCAATCGCCCATGCTGCTGGATTATTAAGGCACTACCGCTAGCCAATGT
gltPATGCGAAGAAACTTGGCCGGATTGTCAACGACGGTTAGCGCAGACATA
katYACCGATGTCAGTTCTTTCGCGGTATCAGGCACGGTCAGTTCCAGTTTA