Table 1

Primers and plasmids used in this work

Primer or plasmidSequence or description
Primers
    lpsbKO1CCCGGATATCGTGATGCAATTTGGTATAGTCC
    lpsbKO2CCCGCATATGACTGATGACCTTGTGCAACC
    lpsbKO3CCCGCATATGCCTCAGCACAGTGGTTTAACC
    lpsbKO4CCCGGATATCTAACGCGCTTGCTGTACTTG
    lpsbKO6TTACCAATGCACAAGCTCAAG
    lpsbKO7TAACCTTGACGGTTCTACGC
    X430FGCCCGAATTCGCTTCGTATCGCACCAACTC
    X430RCCCGGATATCTCAATTCAATACACTTTGATATAGCTC
    16SFCTGTAGCGGGTCTGAGAGGAT
    16SRCCATAAGGCCTTCTTCACAC
    0807FCGCAGCTATTTTAGTTCTTCATCTTC
    0807RCCCGACCACCAAATGC
    1008FCTAAGTATACAGCTGCGATTATGC
    1008RGCGATGAAACCATGCCAG
    3130FGCATTTAGCGGAAGTGATTAGC
    3130RACGAATCGAAATTGCAACCTTG
Plasmids
    pKOlpsBlpsB inactivation vector in pEX100T (this work)
    plpsBlpsB complementation vector (this work)
    pMU125Derivative of pWH1266 containing gfp (40)
    pEX100TsacB-conjugative plasmid for gene replacement (26)