Table 1

Primers and probes for qRT-PCR analysisa

GeneForward primerReverse primerProbe
Arfgap3ATGCTTCTTCCTTCTTCCTCTTGATCTTCTCCCTGTACCAAGGACACCAACGCCA
CopεCAGTGAGAACCAGAGGGAGAGCAGGAAAGTGGTATTACACTCCTGCTCATCTCCCG
GRP78CTATTCCTGCGTCGGTGTGTTGGGTTGGACGTGAGTTGGTTTCAGGGCAACCGCATCACGCCG
SRPRβAGCTAGGGCTGTGGTGTTAGGCTATTAATAAGGACGGTGAGTTTTCGGCCACATCTTTCACCTCCCGCT
Sec24dAGTCCCACCATTCTATTTCCAACATCCGTCTCCTCATGCTCCTCCTTACCTCCCAGCCCACCAGCCTT
Sec61α1GCCCAGAAGTTGTTTGGAATGATGCCAGCAACAAAGAGCTGAATAGGGTCCCCGTACATGCCCGT
CHOPCCACCACACCTGAAAGCAGAAATGAGATATAGGTGCCCCAAACGTGCAGTCATGGCAGCTG
ATF4GCCAAGCACTTGAAACCTCATAACATCCAATCTGTCCCGGAAACACCGGCAAGGAGGATGCC
  • a Primer and probe sequences, shown in the 5′-to-3′ direction, were designed (using the CLC DNA workbench software) to amplify a region of 200-bp sequences within the open reading frames of the following transcripts: Arfgap3, Copε, GRP78, SRPRβ, Sec24d, Sec61α1, CHOP, and ATF4.