Table 2

Primer sequences for quantitative PCR after ChIP

Gene nameForward primerReverse primer
Arfgap3 (distal)CCAAGGCTGTCTCTTCTCTATCCTGTATGAAGGAGTTGGAGAT
Arfgap3 (proximal)CGCAAAGCCTGGGGTTCCTATGGAAGAGACAAGGAGTAGCGGTT
GRP78 (distal)GTGATGCAACTTCTATAGCAAGGATAGGCAGGAAATGACTCCAGTA
GRP78 (proximal)GCGGCGGAGAAAGGGAATAGGTTGAGCTGGGGCCTGATCTGGATT