Table 1

Primer sequences

PrimerDirectionSequence (5′ to 3′)
mBD1ForwardCTGGGAGTTTCACATCCTCTC
ReverseCTCCATGTTGAAGGCATTTGT
mBD2ForwardCTACCAGCCATGAGGACTCTC
ReverseGTACTTGCAACAGGGGTTCTT
mBD3ForwardGGATCCATTACCTTCTGTTTGC
ReverseATTTGAGGAAAGGAACTCCAC
mBD4ForwardGCTTCAGTCATGAGGATCCAT
ReverseCTTGCTGGTTCTTCGTCTTTT
mBD5ForwardCCTTCTCTTTGCATTTCTCCT
ReverseTTTCTCTTGCAGCAGTTGAGA
mBD6ForwardTACCTGCTCTTTGCCTTTATCC
ReverseTTCTGGCACTTATTCACATTGC
mBD14ForwardTCTTGTTCTTGGTGCCTGCT
ReverseCGACCGCTATTAGAACATCGAC
CRAMPForwardGCCGCTGATTCTTTTGACAT
ReverseGCCAAGGCAGGCCTACTACT
RPIIForwardCTACACCACCTACAGCCTCCAG
ReverseTTCAGATGAGGTCCATGAGGAT