TABLE 2

Oligonucleotides used in these studies

PrimerSequence (5′→3′)aDescription
jf031912.1TCCGAGCTCGAGATCCTTGTCACTTGCGTTATTAATGAATAAG (XhoI site underlined)yghJ forward cloning primer
jf031912.2CCCAAGCTTCGAATTCTCGGCAGACATCTTATGCTC (HindIII site underlined)yghJ reverse cloning primer
jf082312.1GCTGATCTGGCATGATGTCGGTCATAACGCC (GAA→GAT mutation underlined)Site-directed mutagenesis (E1309D) forward
jf082312.2GGCGTTATGACCGACATCATGCCAGATCAGCSite-directed mutagenesis (E1309D) reverse
jf082312.3GGCTGATCTGGCATGCAGTCGGTCATAACGC (GAA→GCA mutation underlined)Site-directed mutagenesis (E1309A) forward
jf082312.4GCGTTATGACCGACTGCATGCCAGATCAGCCSite-directed mutagenesis (E1309A) reverse
jf112612.1ACGACTGGCTGATCTGGGCTGAAGTCGGTCATAACG (CAT→GCT mutation underlined)Site-directed mutagenesis (H1308A) forward
jf112612.2CGTTATGACCGACTTCAGCCCAGATCAGCCAGTCGTSite-directed mutagenesis (H1308A) reverse
jf112612.3CTGGCATGAAGTCGGTGCTAACGCCGCAGAAACG (CAT→GCT mutation underlined)Site-directed mutagenesis (H1312A) forward
jf112612.4CGTTTCTGCGGCGTTAGCACCGACTTCATGCCAGSite-directed mutagenesis (H1312A) reverse
jf101712.1GACTGGCTGATCTGG(−66)AACGTGCTGGCGCTGMutagenesis primer to construct 22-amino-acid internal deletion of YghJ residues H1308 to N1329
jf101712.2CAGCGCCAGCACGTT(−66)CCAGATCAGCCAGTCReverse complement of jf101712.1
jf101812.3CCGAAGAAGAACCTGAATGCForward sequencing primer yghJ from nt 3616 to 3635
jf101812.4TTACCGTTGGATTCAGCACAReverse sequencing primer yghJ from nt 4319 to 4300
  • a (−66) indicates the position of the 66-nucleotide in-frame deletion in yghJ extending from nucleotide (nt) 3904 to 3969.