TABLE 2

Primers used in this study

Primer function and nameSequence (5′ →3′)aDesign or referenceb
Cloning
    phtC F GentCTTTCCGCGGGGCTTTTCT71 nt 3′ of the start codon
    phtC R GentATTTGTTCCCGCGTGATGTGTC110 nt 5′ of the stop codon
    etpD/aphA3 FGACGGGCTGAACCTTGG5′ of the start codon
    etpD/aphA3 RGCATGTTTATTCACCCACTG3′ of the stop codon
    phtC comp FGAATTCTTGTTCAATAAAGATACCEcoRI + 76 nt 5′ of the start codon
    phtC comp RAAGCTTTGCTGCAAA ACAAACCHindIII + 86 nt 3′ of the stop codon
    phtD F GentCATGGCTGGTTTGTTTTG48 nt 3′ of the start codon
    phtD R GentAGATACCCGCCTTGAGTTA189 nt 5′ of the stop codon
    phtD comp FGAATTCTCGCAATTGCTGGACTEcoRI + 69 nt 5′ of the start codon
    phtD comp RAAGCTTGTTAGCACCCGCATCHindIII + 85 nt 3′ of the stop codon
    KCDB_F_sac1TGTTGCCCGAGCTCTGCCAAAGTGGASacI + 723 nt 5′ of the tdk start codon
    KCDB_ R_xma1CTTTCATCCCCGGGTTGCCTAGGGTAAXmaI + 273 nt 3′ of the deoB stop codon
RT-PCR
    tdk_RT_FAAATGGGCAAGCTGTTGTTGAGGGFig. 2
    phtC_RT_RAAACCTGTCGAGAATAAGGCCAGCFig. 2
    phtC_RT_FTTGCTCAGGTTCTGTTTGGTTGGCFig. 2
    phtD_RT_RCGAATCTGAGTAGGAGAGGATAAACGFig. 2
    phtD_RT_FTAACTCAAGGCGGGTATCTFig. 2
    deoB_RT_RTAAAGGATAACCCGGAACTGGCCAFig. 2
    motC_RT_FCTCGCTGATCCCAGTCAATTAGFig. 2
    motB_RT_RTGCCGACTTCATTCCTTCAGFig. 2
    mip-sda_RT_FTAGCGTCTTGCATGCCTTTAGFig. 2
    mip-sda_RT_RCCTACTGTGTGTGAGCTTGATGFig. 2
  • a Restriction sites are underlined.

  • b nt, nucleotide(s).