TABLE 2

Sequences of primers used in this study

Primer(s)Primer sequence(s) (5′–3′)aPurpose
Plaup5-Plaup3AATGAGCTCCGGCCAGGCAGATCCACATAATG (SacI), ATCGGATCCTCATTAGACACCCTTAATC (BamHI)PCR amplification of the upstream flanking fragment of the pla gene of Y. pestis CO92
Pladn5-Pladn3ATCGAATTCTGAAAAATACAGATCATATC (EcoRI), TTCGGTACCTATAACTCGTAGGTTATATTG (KpnI)PCR amplification of the downstream flanking fragment of the pla gene of Y. pestis CO92
Km5-Km3ATTCCGGGGATCCGTCGACC (BamHI), CTTGAATTCTGTAGGCTGGAGCTGCTT (EcoRI)PCR amplification of the Kmr gene cassette with FLP recombinase recognition target sites at both ends from plasmid pKD13
Pla5-Pla3TTACAGTTGCAGCCTCCACC, ATTCTTATCAATGGTCTGAGPCR amplification of the coding region of the pla gene of Y. pestis CO92
Up5-Dn3TCCATCTCCGTATCAATCGG, TTGCCGTGATCGCGCTGAACGeneration of the pla mutants of Y. pestis CO92; the pla mutant verification primers were located on the bacterial chromosome outside the flanking DNA sequences
SplaCCACCGTTTCTTATGTGAGCConfirmation of the in-frame deletion of the pla gene by chromosomal DNA sequencing; the primers were located upstream of the pla gene
Cplaup-CpladnATGCATGCGGCTCAACGCTCGTTGTCG (SphI) ACGTCGACTCAGAAGCGATATTGCAGAC (SalI)Amplification of the pla gene and its promoter region for the complementation studies
  • a Underlining indicates the restriction enzyme sites in the primers, and the restriction enzymes are indicated in parentheses.