TABLE 1

V. vulnificus strains, plasmids, and oligonucleotide primers used in the study

Strain, plasmid, or oligonucleotideRelevant characteristic or sequenceaReference
Strains
    BS1405CMCP6 ΔvvhA Rifr18
    BS1406BS1405 ΔrtxA1 Rifr18
    BS1407BS1405 rtxA1::bla Rifr18
    SNG1BS1405 rtxA1::mcf-bla RifrThis study
    SNG2BS1405 rtxA1::mcf(C3351A)-bla RifrThis study
Plasmids
    pHGJ5rtxA1::bla; sacB, oriR6K Cmr18
    pSA8mcf in fusion with bla in pHGJ5; CmrThis study
    pSA9mcf(C3351A) in fusion with bla in pHGJ5; CmrThis study
Oligonucleotides (5′-3′)
    1GAACAGGTCGACGTTCAATGCAGAGCAAGCAGCGThis study
    2GAACAGGTCGACGCCAATGCTTCGAGATCGCTCGCThis study
    3GGTTTTGGTGGGCGTGCTGATCCACTTTCTAAAC26
  • a Bacterial strains and plasmids used are either Rifr (rifampin resistant) or Cmr (chloramphenicol resistant). The enzyme sites in oligonucleotides are in bold. The underlined codon for Cys is exchanged for Ala.