TABLE 2

Primers used in this study

NameSequence (5′→3′)Application
LF82 R upAATGCGGGTAAAGGGTCATTCloning
LF82 R lwCGCGCCATGTAATACTCGTCloning
LF82up-DGpBADAAAGAATTCATGACACCGCATGTGAACloning
LF82lw-DGpBADAAATCTAGAGCAACGCCTATCACCAGACloning
M13 dirGTTTTCCCAGTCACGACVerification-cloning
M13 revCAGGAAACAGCTATGACVerification-cloning
EcE-upCCGATGAACGCATTCGCAAcDNA amplification
EcE-lwAAAGTGCACAGGAGACGCAGReverse transcription-cDNA amplification
EcGAP-upGGCCAGGACATCGTTTCCAcDNA amplification
EcGAP-lwGATGATGTTCTGGGAAGCGCReverse transcription-cDNA amplification
LF82 fliS RT upGCAAGGCAAAGGCGTCTCTTTGTCcDNA amplification
LF82 fliS RT lwGACATCGTTGCGTAAATTGGCTTGCReverse transcription-cDNA amplification
LF82 motA RT upCAATACCAAACGCCGGAAGTGAGTCcDNA amplification
LF82 motA RT lwGATAGCGTCATGCTTGAATTTATCGTCGReverse transcription-cDNA amplification
LF82 cheR RT upGCTCCTGACGCACGCGTACcDNA amplification
LF82 cheR RT lwCAGCATAGCGATGACGCTGGCReverse transcription-cDNA amplification
LF82 kdgK RT upCGAAGCCGCCGCCAAATTCTGGcDNA amplification
LF82 kdgK RT lwGTCTCTTCTTTGCTGGCCCACAGReverse transcription-cDNA amplification
LF82 tsr RT upGCTGGCGGAGCTGATACAACTGcDNA amplification
LF82 tsr RT lwGCCTACCAGAATCCACATCGCCReverse transcription-cDNA amplification
LF82 fliC RT upCGGCAAATACCGCCTGATACGTCcDNA amplification
LF82 fliC RT lwGACTGCATCAGTCACGATGGGGReverse transcription-cDNA amplification
ABc-pBADupAAGAATTCGGAGTGAAAGCATGAATCAGAATCTGCTGpBAD cloning
ABc-pBADlowAATCTAGAGGGCCATTCAGAGCTGGAAGpBAD cloning
ABp-pBADupAAGAATTCGGAGTGTACATGATAAGCATCGTAAAACGTAACpBAD cloning
ABp-pBADlowAATCTAGATCGGTTTACAGGTCAGCAAACpBAD cloning
MInrdR(F)TCAGTTCAGGGTAAAATAGATTTCTGTTAACCACCTGGTCAGGACGCCGTGTAGGCTGGAGCTGCTTCGConstruction of isogenic nrdR mutant
MInrdR(R)CGTTGCGCCAGCTTTAGCGCCCGCGCCATGTAATACTCGTCCTGCACGGCCATATGAATATCCTCCTTAGConstruction of isogenic nrdR mutant
MInrdAc(F)CTCACTACAGGTAGTCTGCATGAAGCTATTGAAAAACAGGTACGACATACGTAGGCTGGAGCTGCTTCGConstruction of isogenic nrdAc mutant
MInrdAc(R)TGGACCCGTAGGCCGGGTAGGGCGCTCACGCCGCATCCGGCATCACAATACATATGAATATCCTCCTTAGConstruction of isogenic nrdAc mutant
MInrdAp(F)TCTATTAACATGGGCCACTATATTTAGTGGCCCTCTTTATTTGGTGATACGTAGGCTGGAGCTGCTTCGConstruction of isogenic nrdAp mutant
MInrdAp(R)AAACAAGGCTTACAAATCAAAGAGAAGGTGGGGATATCCCCCACCATATGCATATGAATATCCTCCTTAGConstruction of isogenic nrdAp mutant
MInrdD(F)GCCTTTCCCAATTTCTGTGGATAACCTGTTCTTAAAAATATGGAGCGATCGTAGGCTGGAGCTGCTTCGConstruction of isogenic nrdD mutant
MInrdD(R)GGATAAGGCGTTTACGCCGCATCCGGCATTTGCTTAACACAGAGTGAAGACATATGAATATCCTCCTTAGConstruction of isogenic nrdD mutant
MInrdE(F)GTAACCGAATTTTGGCAACGACAACCGCAGAACGCCTGACGCAGGAAACGGTAGGCTGGAGCTGCTTCGConstruction of isogenic nrdE mutant
MInrdE(R)ATCTTGTTCCAGTTGATGGCGCTGATACGTGAGAGTTTCATAGATATTCCCATATGAATATCCTCCTTAGConstruction of isogenic nrdE mutant