TABLE 6

Alignment of pheV and phe′V DR at genomic-island boundaries

pheV islandDirect-repeat sequenceaDescriptor
VR50 pheVTTCGATTCCGAGTCCGGGCACCA54–76
VR50 phe′VTTTCATTCCGATTCCGGGCACCA19/19-nt DR
VR50 phe′V2TTTCATTCCGAGTCCGGGCACCA19/19-nt DR
Nissle pheVTTCGATTCCGAGTCCGGGCACCA54–76
Nissle phe′VTTTCATTCCGATTCCGGGCACCA19/19-nt DR
CFT073 pheVTTCGATTCCGAGTCCGGGCACCA54–76
CFT073 phe′VTTTCATTCCGATTCCGGGCACCA19/19-nt DR
UMN026 pheVTTCGATTCCGAGTCCGGGCACCA54–76
UMN026 phe′VTTTCATTCCGATTCCGGGCACCA19/19-nt DR
536 pheVTTCGATTCCGAGTCCGGGCACCA54–76
536 phe′VTTCGATTCCGAGTCCGG-CACCA23/22-nt DR
APECO1 pheVTTCGATTCCGAGTCCGGGCACCA54–76
APECO1 phe′VTTCGATTCCGAGTCCGG-CACCA23/22-nt DR
SMS_3_5 pheVTTCGATTCCGAGTCCGGGCACCA54–76
SMS_3_5 phe′VTTTTATTCCGAGTCCGGGCACCA19/19-nt DR
  • a The columns in boldface contain differences (underlined) in phe′V (the direct repeat at the 3′ end of island) relative to the pheV tRNA gene. The nucleotides in italics are not considered part of the phe′V repeat. The complete 76-nt pheV tRNA gene is 100% identical in all the E. coli strains shown here.