TABLE 1

Primers used for quantitative real-time PCR

Gene productPrimer sequence (5′→3′)
ForwardReverse
GAPDHTGAAGGTCGGTGTGAACGGATTTGGACGACATACTCAGCACCGGCCTCAC
IFN-γAGCGGCTGACTGAACTCAGATTGTAGGTCACAGTTTTCAGCTGTATAGGG
TNF-αGGCAGGTCTACTTTGGAGTCATTGCACATTCGAGGCTCCAGTGAATTCGG
IL-6TGGAGTCACAGAAGGAGTGGCTAAGTCTGACCACAGTGAGGAATGTCCAC
IL-2AGCAGCTGTTGATGGACCTACGCAGAGGTCCAAGTTCAT
Foxp3GGCCCTTCTCCAGGACAGAGCTGATCATGGCTGGGTTGT
T-betTCCTGCAGTCTCTCCACAAGTCAGCTGAGTGATCTCTGCGT
STAT4GAATGTGGAACACAAAGTGTCTGCCCATTTTAGTAGATTGCTCCTGTAG
IL-12p35ACCTGCTGAAGACCACAGATGACATAGCCAGGCAACTCTCGTTCTTGT
IL-12Rβ2ACATAGTGGACCTATGTGGCGCTTATTGGATGTGAGTTTTG