TABLE 1

Primer sets used for PCR analyses

AnalyteForward primerReverse primer
18SCTCAACACGGGAAACCTCACGTTCCACCAACTAAGAACG
AhRCGGAGCGCTGCTTCCTCCACGCTGCCCTTTGGCATCACAACC
Foxp3CCCAGGAAAGACAGCAACCTTTTCTCACAACCAGGCCACTTG
GAPDHACGGCCGCATCTTCTTGTGCACGGCCAAATCCGTTCACACCGA
IFN-γTGAACGCTACACACTGCATCTTGGCGACTCCTTTTCCGCTTCCTGAG
IL-6TTCCATCCAGTTGCCTTCTTGTTGGGAGTGGTATCCTCTGTGA
IL-10GCTCTTACTGACTGGCATGAGCGCAGCTCTAGGAGCATGTG
IL-12p40GCTGGACCCTTGCATCTGGCGGGTGGCCAAAAAGAGGAGGTAGCG
IL-17ATCCAGAAGGCCCTCAGACTATGAGCTTCCCAGATCACAGA
SOCS1GCATCCCTCTTAACCCGGTACAATAAGGCGCCCCCACTTA
SOCS2CGCGTCTGGCGAAAGCTTCTGGAGCCTCTTTTAATTTCTCTT
SOCS3TTTGCGCTTTGATTTGGTTTGTGGTTATTTCTTTGGCCAGCA
TNFACGGCATGGATCTCAAAGACAGATAGCAAATCGGCTGACG
T. cruzi 18STTGTTTGGTTGATTCCGTCACCCAGAACATTGAGGAGCAT