TABLE 2

Primers used in this study

PrimerDNA sequence (5′–3′)Use
fur-delta1GCGGGATCCCGGGCTACCACTTCGAAGCfur mutant construction
fur-delta2TCAGGCTGGCTTATTTGCCTTCGTTATCAGTCATGCGGAATCfur mutant construction
fur-delta3CAGATTCCGCATGACTGATAACGAAGGCAAATAAGCCAGCCfur mutant construction
fur-delta4GCGGTCGACGCGGCAGGTTTTGTGCCTGfur mutant construction
ryhB-delta1GGGAGTCGACACAGATACCryhB mutant construction
ryhB-delta2TTACACCTTAGCGCAAAGCGGACGGGTCTTCCTGATCGCGAGryhB mutant construction
ryhB-delta3TTGTCTCGCGATCAGGAAGACCCGTCCGCTTTGCGCTAAGGTGryhB mutant construction
ryhB-delta4GCGGGATCCACGGCGTAACGATCAGCCCryhB mutant construction
lrp-delta1GCGGGATCCCAATCGGCAGCATCGATAAGClrp mutant construction
lrp-delta2CTGTTCCGTGTTAGCGCGTCTTGCTATCTACCATTATTATTGTClrp mutant construction
lrp-delta3GACAATAATAATGGTAGATAGCAAGACGCGCTAACACGGAAClrp mutant construction
lrp-delta4GCGGTCGACATTCGTCGCTGGACTGATGAClrp mutant construction
pTrc-fur-FGCGCCATGGCTGATAACAATACCGCCpTrc99Afur construction
pTrc-fur-RGCGGTCGACTTATTTGCCTTCGTGCGCGpTrc99Afur construction
pTrc-fur-6His-RGCGGTCGACTTAGTGATGGTGATGGTGATGTTTGCCTTCGTGCGCGTGCpTrc99Afur6His construction
pTrc-ryhB-FGCGGAATTCGTGTTGGACAAGTGCGAATGpTrc99AryhB construction
pTrc-ryhB-RGCGAAGCTTAAAGCGGACGTGGTTCCTACpTrc99AryhB construction
ryhB-FGCGAAGCTTTGTTTCTGCGTGGCGTATTACpUC19ryhB construction
ryhB-RGCGGGATCCAAAGCGGACGTGGTTCCTACpUC19ryhB construction
rrsA-qPCR-FCGGTGGAGCATGTGGTTTAAQuantitative real-time PCR
rrsA-qPCR-RGAAAACTTCCGTGGATGTCAAGAQuantitative real-time PCR
rpoD-qPCR-FCAAGCCGTGGTCGGAAAAQuantitative real-time PCR
rpoD-qPCR-RGGGCGCGATGCACTTCTQuantitative real-time PCR
fimA-qPCR-FTGCGGGTAGCGCAACAAQuantitative real-time PCR
fimA-qPCR-RACGCAGTCCCTGTTTTATCCAQuantitative real-time PCR
fimH-qPCR-FGATGCGGGCAACTCGATTQuantitative real-time PCR
fimH-qPCR-RCCCTGCGCGGGTGAAQuantitative real-time PCR
papA-qPCR-FTTTTTCGGGTGTCCCAAGTGQuantitative real-time PCR
papA-qPCR-RTGTTGCACCGACGGTCTGTQuantitative real-time PCR
papG-qPCR-FGGGAGGGAATGTGGTGATTACTCQuantitative real-time PCR
papG-qPCR-RCGGGCGCCACGAAGTQuantitative real-time PCR
flhD-qPCR-FGACAACGTTAGCGGCACTGAQuantitative real-time PCR
flhD-qPCR-RTTGATTGGTTTCTGCCAGCTTQuantitative real-time PCR
fliA-qPCR-FCGAGCGTGGAACTTGACGATQuantitative real-time PCR
fliA-qPCR-RCGACGGCATTAAGTAACCCAATQuantitative real-time PCR
fliC-qPCR-FTCCACTGAAAGCTCTGGATGAAQuantitative real-time PCR
fliC-qPCR-RCCCAGGGATGAACGGAATTQuantitative real-time PCR
fim-phase-FGAGAAGAAGCTTGATTTAACTAATTGPhase variation assay
fim-phase-FAGAGCCGCTGTAGAACTCAGGPhase variation assay