TABLE 3

Primers used in this study

Primer nameSequence 5′→3′
W69TGAGACGTCGACGGGCACCTCACTTTAGCACTGAAGCC
W70GTGTCAGTCGACGCGTTTTCAAGGATTAGTCCTTAATCGG
W401AACGTCAATGAGCAAAGGTATTAA
W402TACGGGAGGCAGCAGTGG
W403GGACTAATAGCAGGTTAC
W404GCAGTTAATCCAATATAAGG
W408CACTAGGTTCTGATCTGGCACGG
W409CTCGATGCCAATCGCTTTTGCC
W410CTTCTGGGAATAGTCCTGACAACC
W411GAGTTGACTGACTTTTCGGCCTCC
W424AAAGTAGATTCCTTTACGACCG
W425AATGAACAAAACGCAGGGTGTC
W537TCATTCAAGCTTCAAGAACCGCAACTATCGCTACAAT
W556TCATTCGGATCCCCCCCTTCATTTCACCCTTTGGCCTG
W565CAAATAGGGGTTCCGCGCACATTTC
W566GGGGCCTGCCACCATACCCACGCCG