TABLE 1

Bacterial strains, plasmids, and primers

Strain, plasmid, or primerDescription or sequenceSource or reference
Strains
    PAO1Wild typeR. E. Hancock
    eddB::luxMini-Tn5-lux insertion mutant in PA3909 (EddB); transcriptional lux fusion29
    eddA::lacZMini-Tn5-lacZ insertion mutant in PA3910 (EddA)46
    ΔeddABUnmarked deletion mutant of eddABThis study
    xcpU::luxMini-Tn5-lux insertion mutant in xcpU; nontranscriptional lux fusion45
Plasmids
    pEddAEddA as an EcoRI-HindIII fragment in pPSV37 with a C-terminal His tag (EddA-His6)This study
    pEddBEddB cloned as a BamHI-XhoI fragment into pUCP22This study
    pPSV37IPTG-inducible expression vector; Genr44
    pUCP22Multicopy shuttle cloning vector; Ampr Genr47
Primers
    16SrtFGAAATCCCCGGGCTCAACCTG45
    16SrtRCCCCACGCTTTCGCACCTCA45
    EddB-FGAGGATCCATGCACCCCTTGCGTAACGCThis study
    EddB-RGACTCGAGCTACCTGCGGTGCTTCTTCATCGThis study
    EddA-soe-FAAGCCTGAAACTCACTGAAGThis study
    EddA-soe-RATACGCATGCCGCCGATATCCGGATTGATCCCGAAACThis study
    EddB-soe-FCGGCGGCATGCGTATAGGAAAGGGCTATTCCTACGThis study
    EddB-soe-RTGGAGTGACCTCCGTTCCThis study
    EddA-RBS-FATGCGAATTCAGGAGGAAACGATGAGTGGGATGGACCTCAAGCGCThis study
    EddA-6×His-RATGCAAGCTTTCAGTGGTGATGGTGATGATGGGCGCCGTCGGGCTGCAGTTCCTGThis study