Table 1.

Gene probes used in this study

Gene or probeDescription of target (reference)Location of geneSize of probePCR primers or restriction fragmenta (reference)
aggAAAF/I fimbrial subunit (37)Plasmid450 bp(a)TTAGTCTTCTATCTAGGG (b) AAATTAATTCCGGCATGG
shfCryptic ORF (this study)Plasmid613 bp(a)ACTTTCTCCCGAGACATTC (b) CTTTAGCGGGAGCATTCAT
aspUCryptic secreted protein (25)Plasmid232 bp(a) CTTTTCTGGCATCTTGGGT (b)GTAACAACCCCTTTGGAAGT
aggRTranscriptional activator of AAFs (24)Plasmid308 bp(a)CTAATTGTACAATCGATGTA (b) ATGAAGTAATTCTTGAAT
sheSecreted protein of S. flexneri(33)Chromosome1175 bp(a)GGGTATTGTCCGTTCCGAT (b) ACAACGATACCGTCTCCCG
sigAAutotransporter homolog of S. flexneri chromosome (33)Chromosome2.5 kb(a) AATGTCAGGGTTCCGGCCAG (b)CAGCCCGGGCCGCGTTTGCG
irp2Yersiniabactin biosynthetic gene (38)Chromosome264 bp(a)AAGGATTCGCTGTTACCGGAC (b)TCGTCGGGCAGCGTTTCTTCT (38)
aafAAAF/II fimbrial subunit (10)Plasmid770 bpEcoRI/PstI fragment from pJC2 (10)
CVD432AA probe (2)Plasmid0.7 kbEcoRI/PstI fragment from pCVD432 (2)
pet104-kDa enterotoxin (13)Plasmid2.2 kbPstI/ApaI fragment pJPN205 (13)
  • a Primers (upstream [a] and downstream [b]) are written 5′→3′. Primers not referenced were derived in this study.